ID: 1073185871

View in Genome Browser
Species Human (GRCh38)
Location 10:101614720-101614742
Sequence AACAGAGCCTTGAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073185871_1073185876 -6 Left 1073185871 10:101614720-101614742 CCCAGGACCCTCAAGGCTCTGTT 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1073185876 10:101614737-101614759 TCTGTTGTGTGGTGCCCGTGAGG No data
1073185871_1073185879 25 Left 1073185871 10:101614720-101614742 CCCAGGACCCTCAAGGCTCTGTT 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1073185879 10:101614768-101614790 AGAGCATAAACTGACACGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073185871 Original CRISPR AACAGAGCCTTGAGGGTCCT GGG (reversed) Intronic
900752187 1:4405557-4405579 GACAGGGCCTTGGGGGGCCTGGG + Intergenic
901927845 1:12578291-12578313 AACAGAGGGTAGAGGCTCCTTGG + Intronic
902577785 1:17389265-17389287 AGCAGAGCCCTGTGGGCCCTGGG + Intronic
902578322 1:17392478-17392500 ATCAGAGCCTTCCGGGGCCTGGG - Intronic
903156915 1:21451667-21451689 AACAGGGCATAGTGGGTCCTGGG + Intronic
903874549 1:26464528-26464550 AACAGAGCTTTGAAGCTTCTGGG - Intronic
903957369 1:27034571-27034593 AACACAGCCCTGAGGACCCTGGG - Intergenic
906510615 1:46408556-46408578 AACAGAGCCTTGAGGCTGCGGGG + Exonic
906666039 1:47622770-47622792 CCCAGAGCCTAGAGCGTCCTGGG + Intergenic
906805849 1:48777903-48777925 AAGAGAGCCTGGAGGGGCTTGGG + Intronic
912624697 1:111197410-111197432 AAGAAATCCTTGAGGGTACTGGG + Intronic
913075057 1:115335231-115335253 AACTGAGGCTTTGGGGTCCTCGG - Intronic
915195368 1:154185045-154185067 AACAGTTCCTTGGGGGTACTTGG - Intronic
915596317 1:156898301-156898323 AACAGAAGCTAGAGGGTCCTAGG - Intronic
917700374 1:177574500-177574522 CACTGAGTCCTGAGGGTCCTGGG - Intergenic
919819685 1:201465336-201465358 GACAGGGCCTTGGTGGTCCTAGG - Intergenic
921958188 1:221005895-221005917 AACAAAACGCTGAGGGTCCTAGG - Intergenic
922230226 1:223679412-223679434 ACCAGAGCCTTGATGGTGCCAGG + Intergenic
923486295 1:234434686-234434708 GACAGAGATTTGAGGGTCCCTGG + Intronic
1064426861 10:15237077-15237099 AAGAGGGCCTTGAGGCTCCTGGG + Intronic
1064555172 10:16540689-16540711 ACCAGAGCCTCCAGGGACCTTGG - Intergenic
1065960216 10:30727894-30727916 GACAGAGTCCAGAGGGTCCTGGG - Intergenic
1067711128 10:48651996-48652018 AACAGAGACTTCAGGGTCCTGGG - Intronic
1069784004 10:70976630-70976652 AACAGAGCCTTGGGGGCTCATGG + Intergenic
1072577672 10:96715302-96715324 ATCACAGCCTTGAAGGGCCTAGG + Intronic
1072713913 10:97736954-97736976 CACAAAGCCTTGAGGACCCTTGG - Intergenic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1075643734 10:124084260-124084282 AAGACAGCCAGGAGGGTCCTGGG - Intronic
1076491512 10:130864853-130864875 AACAGAGGGTTGGGGGGCCTCGG - Intergenic
1077659632 11:4056127-4056149 AAAAGAGCCCTGAGGCTCCCGGG - Intronic
1081681799 11:45011447-45011469 AGCAGAGCCTTGAGGCTCAGTGG + Intergenic
1081744746 11:45464960-45464982 ATGAGAGCTTTGAGGGTCCCAGG + Intergenic
1083632918 11:64104919-64104941 CACAGAGGCTTGAGGTTGCTGGG - Intronic
1085358354 11:75861153-75861175 AACAGATAATTGAAGGTCCTTGG - Intronic
1087660401 11:100981283-100981305 ATCAGAGGCTTGAGTGTCTTAGG - Intronic
1090021185 11:123130364-123130386 GGCAAAGCCTTGATGGTCCTGGG - Intronic
1090351196 11:126109726-126109748 ACCAGAGCCTTGTGGGACCCAGG - Intergenic
1091131452 11:133150429-133150451 AACAGAGGGTTCAGAGTCCTGGG - Intronic
1092751981 12:11727564-11727586 AACAGACCCTTTAGCCTCCTTGG + Intronic
1095369211 12:41446330-41446352 AACAGACCCTTAAGAGGCCTAGG - Intronic
1102348669 12:112176054-112176076 GACAGAGCCCTCAGGGGCCTGGG - Intronic
1102416988 12:112772364-112772386 AACAGAGCATTTAGAATCCTTGG + Intronic
1102462175 12:113106595-113106617 TAGAGAGCCTTGAGGATCCTGGG - Intronic
1103139501 12:118536228-118536250 TGCAGAGGCTTGAGGGTCATGGG + Intergenic
1103704060 12:122861900-122861922 TACTGAGCCTGCAGGGTCCTGGG + Exonic
1103935720 12:124475425-124475447 AACAGAGCCTGGAGGCCACTGGG + Intronic
1104723332 12:131059015-131059037 AACAGAGCCTTGAGGACCCGTGG - Intronic
1105071103 12:133235222-133235244 AACAGAGCCTGCAGGGGCCTTGG + Exonic
1107761572 13:43685074-43685096 AGCACAGCCTTGGGGATCCTGGG - Intronic
1110343978 13:74424882-74424904 AACAAAACCTTGAGTGTACTTGG + Intergenic
1110380416 13:74844013-74844035 AAAAGAACCTTGAGGCTCCAGGG - Intergenic
1113638855 13:111943176-111943198 AACAGGGCCCAGAGGGTGCTCGG + Intergenic
1113657620 13:112078232-112078254 GACAGAGCCTTTGGGGTCCACGG - Intergenic
1114896880 14:27001679-27001701 AACTGAGCATCGAAGGTCCTGGG - Intergenic
1115755072 14:36521061-36521083 CCCCGCGCCTTGAGGGTCCTTGG + Intronic
1117984587 14:61374719-61374741 TACAGAGCAGTGAGGGCCCTAGG + Intronic
1118038397 14:61892475-61892497 AACAGAGCCATGAGAGGGCTGGG - Intergenic
1118759319 14:68869822-68869844 ATCATAGCCTTCAGGGTCCATGG - Intergenic
1123134661 14:106016212-106016234 AACTGAGCCTTGGGGGCCTTTGG + Intergenic
1123584638 15:21746338-21746360 AACTGAGCCTTGGGGGCCTTTGG + Intergenic
1123621283 15:22188945-22188967 AACTGAGCCTTGGGGGCCTTTGG + Intergenic
1124388200 15:29227271-29227293 GGCAGAGCCATGAGGGTTCTGGG - Intronic
1124996105 15:34724242-34724264 AAAGGAGCCTTGAGATTCCTTGG + Intergenic
1125722160 15:41850510-41850532 AACAGAGCCTGGAAAGCCCTTGG + Intronic
1125749269 15:42017854-42017876 ATCAGAGCCATAAGGGTCTTTGG + Intronic
1128638322 15:69317408-69317430 AGCAGAGACTGGAGGGTACTAGG - Intronic
1129275042 15:74439728-74439750 ATCAGAGCTGGGAGGGTCCTGGG - Intergenic
1131462587 15:92629078-92629100 AGCACAGCCTTGGCGGTCCTTGG - Intronic
1132166723 15:99599982-99600004 ATAAGAGACTTGAGTGTCCTAGG + Intronic
1132633981 16:933913-933935 CACACAGCCTTGAGCGTCCACGG + Intronic
1132734155 16:1377405-1377427 TACAGAGTCCTGAGGGGCCTGGG - Intronic
1133148577 16:3808976-3808998 AACAGAGCCCAGAGGACCCTAGG - Intronic
1133403040 16:5502615-5502637 AACAGAGGCTGGAGGCGCCTTGG - Intergenic
1134059929 16:11193041-11193063 CACTGAGCCTGGAGTGTCCTAGG - Intergenic
1138563846 16:57818270-57818292 AACAAAACCTTGAGGGGCTTGGG + Intronic
1139549380 16:67665048-67665070 CACAGAGCTTTCAGGGGCCTGGG + Exonic
1143504335 17:7355621-7355643 CACAGAGTCCTGAGGGTCATGGG + Exonic
1147924207 17:43936512-43936534 AAAAGAGGGTTGAGGGGCCTAGG + Intergenic
1148451478 17:47780950-47780972 AACAAAGACTTGCAGGTCCTCGG + Intergenic
1149469264 17:56902667-56902689 AACATGGCCTGCAGGGTCCTAGG - Intronic
1152019378 17:77772506-77772528 AACAAAGCCCTGGGGGACCTTGG - Intergenic
1154438983 18:14370168-14370190 AAAAGAGGCTTCAGGGACCTTGG + Intergenic
1155524267 18:26700531-26700553 GACAGAGCCCTGAGGCTCTTTGG + Intergenic
1157035467 18:43967894-43967916 AACATACCCTTCAGTGTCCTGGG + Intergenic
1159447714 18:68560504-68560526 GGCAGAACCTTCAGGGTCCTTGG + Intergenic
1160799186 19:959958-959980 GGCAGCGGCTTGAGGGTCCTAGG + Intronic
1161190660 19:2953462-2953484 GACAGAGCCTTCAGGGAGCTTGG - Intergenic
1161684610 19:5696591-5696613 AGCCGAGCCTTCCGGGTCCTAGG - Intronic
1162946418 19:14046591-14046613 AACAGAGCACTGAGGTTCCCAGG - Exonic
1162974943 19:14203274-14203296 ACGAGAGCCTTGTGTGTCCTTGG + Intronic
1163235991 19:16031088-16031110 AGCTCAGCCTCGAGGGTCCTGGG + Intergenic
1164980106 19:32607449-32607471 CACAGAGCCTTGATGCTCCCTGG - Intronic
1165785614 19:38460052-38460074 AACAGAGCATTCGGGGTCATTGG - Intronic
1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG + Intronic
1168171506 19:54592946-54592968 AACAGAGGCCAGAGGGTCCCAGG - Intronic
1168277946 19:55287371-55287393 AACAGGGCCTAGGGGGACCTGGG + Intronic
927259249 2:21070270-21070292 AACATAGTCTTGTGGGTACTTGG + Intergenic
928236170 2:29543161-29543183 AACAGAGGCTTGGAGCTCCTGGG + Intronic
928428821 2:31201283-31201305 TACAGACCCTAGAGGGTACTTGG - Intronic
930177497 2:48315173-48315195 AGCCGAGCCCTGAGGGTCCTTGG - Intronic
932659821 2:73642326-73642348 ACAAGAGCCTTGAGTGTCCAGGG + Exonic
932666387 2:73702002-73702024 ACAAGAGCCTTGAGTGTCCAGGG + Intergenic
932668662 2:73718402-73718424 ACAAGAGCCTTGAGCGTCCATGG + Intergenic
933975541 2:87506457-87506479 ATCAGAGACTTGAGCATCCTTGG - Intergenic
934935694 2:98463763-98463785 ACCAGAGCCATGAGCGTCCATGG + Intronic
936318284 2:111444356-111444378 ATCAGAGACTTGAGCATCCTTGG + Intergenic
944479788 2:200144740-200144762 CACAGAGCAGTGAGGGCCCTAGG + Intergenic
944880646 2:204009481-204009503 AATGGAGCCTGGAGGGTCCCAGG - Intergenic
947058155 2:226131494-226131516 GACAGAGCCTGGAGTGTTCTGGG - Intergenic
947796357 2:232896494-232896516 AACAGAGCAGTGAGGAGCCTGGG + Intronic
948234396 2:236377168-236377190 TACAGAGACTCGATGGTCCTGGG + Exonic
1169663993 20:8014271-8014293 AACAGAACCTGGAAGGTCCTAGG + Intronic
1170512934 20:17097639-17097661 AGCAGAGCTTTGATGGCCCTGGG - Intergenic
1171385892 20:24769375-24769397 ATCAGAGGATTGAGTGTCCTGGG - Intergenic
1175283446 20:57820818-57820840 AACAGTGCCTTCAGAGACCTTGG + Intergenic
1176254823 20:64146427-64146449 AACAGAGTCTTGAGGGGCTGGGG - Intergenic
1176456702 21:6919261-6919283 AAAAGAGGCTTCAGGGACCTTGG - Intergenic
1176834874 21:13784320-13784342 AAAAGAGGCTTCAGGGACCTTGG - Intergenic
1179013538 21:37574946-37574968 ACCAGAGCGCTAAGGGTCCTCGG + Intergenic
1179392476 21:41006538-41006560 ATCAGAGCCTGCAAGGTCCTGGG - Intergenic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181394429 22:22609443-22609465 AAAAGAGCTGTGAGGGCCCTGGG - Intergenic
1182879749 22:33723316-33723338 AGCACAGCCTTCAGGGTCCAGGG + Intronic
1182995362 22:34807273-34807295 AAGAGAGCCTTGTGGCTCCGGGG + Intergenic
1184072654 22:42155438-42155460 AGCAGTGCCATGAGGGTCCATGG + Intergenic
950263615 3:11559524-11559546 GACAGAGCCTGAAGGGTGCTGGG - Intronic
950526003 3:13523647-13523669 AAGAGAGCCTTGGGATTCCTGGG - Intergenic
953184681 3:40626877-40626899 ACCAGATGCTTGAGGGGCCTTGG + Intergenic
953837398 3:46358714-46358736 CACACAGCCCTGAGGTTCCTGGG - Intronic
955586036 3:60479260-60479282 AACAAAGTTTTGAGTGTCCTAGG + Intronic
960672719 3:120168097-120168119 CACAAAGCCTTGAGGGGCCTGGG - Exonic
961050012 3:123737979-123738001 AACAGGGCAGTGAGGATCCTAGG - Intronic
964892475 3:161553550-161553572 AACAGTGCCTGGATGGTTCTTGG + Intergenic
970239053 4:13989099-13989121 AACACAACCTTGAGGGCTCTGGG - Intergenic
975727998 4:77311006-77311028 AACATAGCATTGAGAGTCCTGGG - Intronic
978483192 4:109218457-109218479 AACAGAGGCTGGATTGTCCTGGG - Intronic
980688499 4:136260924-136260946 AACTGAGCCATGAGGCTCCTTGG - Intergenic
981796489 4:148600918-148600940 AAGTGAACTTTGAGGGTCCTTGG + Intergenic
983191105 4:164754334-164754356 AACAGAGTCTTCAGTGTCTTGGG - Intergenic
988963815 5:36395128-36395150 ATCAGAGACTTGAGCATCCTTGG - Intergenic
989635741 5:43530970-43530992 ACCAGACCTTTGAGGGTCCCAGG - Intronic
993320245 5:86461680-86461702 AGCAGAGCCTTGAGAGGCCATGG + Intergenic
995119545 5:108521133-108521155 AATAGAGCCTTGGAGCTCCTGGG + Intergenic
1004707792 6:18140827-18140849 AACATAGACTTTAGGATCCTGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006431482 6:34000079-34000101 ACCAAAGACTTGTGGGTCCTGGG + Intergenic
1007607891 6:43129622-43129644 CACAGAGCCTCGAGGTTCCACGG + Intronic
1010020166 6:71150211-71150233 AACAGGGCTTTGAGCGTCATGGG - Intergenic
1012935465 6:105363377-105363399 AACAGAGCTTTGTGGGTTTTTGG + Intronic
1015712254 6:136154972-136154994 AACAGAGCCATTAATGTCCTTGG - Intronic
1019315039 7:380413-380435 TTCTGAGCATTGAGGGTCCTGGG - Intergenic
1022714481 7:32886558-32886580 ATCAGAGACCTGAGTGTCCTTGG + Intronic
1023526543 7:41109428-41109450 ATCAGAGCCTTGGGGGTCCCTGG + Intergenic
1024543296 7:50496839-50496861 AGCAGAAGCTTGAGGGACCTGGG + Intronic
1024567303 7:50692218-50692240 ATCAGGGCCTTGAGCATCCTTGG + Intronic
1028581380 7:92413051-92413073 AACATACCCTTCAGGGTCCAGGG + Intergenic
1029142134 7:98418863-98418885 GACAGAGCCTGCAGGGTACTGGG + Intergenic
1029887856 7:103891819-103891841 AACTGAGGCTTGAGGGTATTAGG - Intronic
1030265278 7:107614765-107614787 AACTGAGCCCTCAGTGTCCTGGG - Intronic
1030821664 7:114099718-114099740 ATCAGAGACTTGAGCATCCTTGG - Intronic
1031012240 7:116536542-116536564 ACCAGAGCCTTGAGGGGTCGTGG + Intronic
1033363904 7:140656937-140656959 ATCAGAGCCTTGAGAGGCCAGGG + Intronic
1034674670 7:152883950-152883972 GACAGAGCCGTGTGTGTCCTGGG + Intergenic
1035637674 8:1159056-1159078 AACAGAGCAGTGTGGCTCCTGGG - Intergenic
1037378335 8:18257263-18257285 AACAGTGACTTTAGGGTCTTTGG - Intergenic
1037414165 8:18630946-18630968 ATCAGGGACTTGAGTGTCCTTGG + Intronic
1041902042 8:62993022-62993044 AACAAAACCTTCAGGATCCTAGG - Intronic
1042350444 8:67771985-67772007 ACCAGAGTCATGAGGGTTCTGGG + Intergenic
1043540551 8:81257611-81257633 ATCAAAGACTTGAGGGTTCTAGG + Intergenic
1044182978 8:89218526-89218548 CACATGGCCTGGAGGGTCCTAGG + Intergenic
1046258011 8:111726053-111726075 AAGAGAGGCTTGAAGGTCTTAGG + Intergenic
1047501762 8:125447032-125447054 AACACAGCCGAGAGGATCCTAGG + Intergenic
1048387991 8:133930978-133931000 TGCAGAGCCTTGAGGGTGCTTGG - Intergenic
1049759452 8:144325531-144325553 AACAAAGCCCTGAGGGCCCCTGG + Intronic
1050803564 9:9645215-9645237 AAGGGAGCCTTGTGGGCCCTTGG + Intronic
1052786267 9:32831262-32831284 AACAGAGTCTTCAGGGTCTCTGG + Intergenic
1055708969 9:79037741-79037763 AAAAGAGCCTTGTGAGTCGTCGG - Intergenic
1056466689 9:86863096-86863118 ATCAGAGACTTGAGCATCCTCGG + Intergenic
1056949319 9:91029379-91029401 CACAGAGCCTTTAGGGGCCTGGG - Intergenic
1057507253 9:95645394-95645416 AAGAGAGCATTGAGAGTCCATGG - Intergenic
1057523277 9:95777623-95777645 TACAGAGCCCTCAGGGCCCTAGG + Intergenic
1059591168 9:115664125-115664147 AACACAGACTTGAGCATCCTTGG + Intergenic
1060421472 9:123472564-123472586 AACAGTGCCTCGAGTGTCCAGGG + Intronic
1062128687 9:134880831-134880853 GACAGAGCTGTGGGGGTCCTGGG + Exonic
1062270182 9:135704695-135704717 ATCAGGGCCTAGAGGGTCCCAGG - Intronic
1062426268 9:136507600-136507622 AACAGACCCTGGCGGGGCCTCGG + Intronic
1062546354 9:137065292-137065314 CAGAGAGCCTAGAGGGTCCCAGG + Intronic
1186171312 X:6879913-6879935 AACAGAGCCTGGACTGTTCTAGG + Intergenic
1187328291 X:18312326-18312348 ATCAGGGACTTGAGTGTCCTTGG - Intronic
1190539663 X:51464087-51464109 ATCAGAGCTTGGAGGGTCCAGGG - Intergenic
1198681441 X:139186893-139186915 AACACAGCCTTGAAGGACCAGGG - Intronic
1199035200 X:143042052-143042074 AACAGAGCTTTTGGGGTCATGGG + Intergenic
1199043575 X:143142059-143142081 AAGATAAACTTGAGGGTCCTGGG + Intergenic
1201260028 Y:12149855-12149877 AACAGAAGCTGGATGGTCCTTGG + Intergenic