ID: 1073186425

View in Genome Browser
Species Human (GRCh38)
Location 10:101617989-101618011
Sequence CAGGCCCCTGCACAAGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073186418_1073186425 -9 Left 1073186418 10:101617975-101617997 CCCTGACTGTGGGCCAGGCCCCT 0: 1
1: 0
2: 4
3: 32
4: 274
Right 1073186425 10:101617989-101618011 CAGGCCCCTGCACAAGGTGGGGG No data
1073186416_1073186425 0 Left 1073186416 10:101617966-101617988 CCGTAATCACCCTGACTGTGGGC 0: 1
1: 0
2: 0
3: 14
4: 112
Right 1073186425 10:101617989-101618011 CAGGCCCCTGCACAAGGTGGGGG No data
1073186419_1073186425 -10 Left 1073186419 10:101617976-101617998 CCTGACTGTGGGCCAGGCCCCTG 0: 1
1: 0
2: 3
3: 44
4: 329
Right 1073186425 10:101617989-101618011 CAGGCCCCTGCACAAGGTGGGGG No data
1073186414_1073186425 1 Left 1073186414 10:101617965-101617987 CCCGTAATCACCCTGACTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 132
Right 1073186425 10:101617989-101618011 CAGGCCCCTGCACAAGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073186425 Original CRISPR CAGGCCCCTGCACAAGGTGG GGG Intronic
No off target data available for this crispr