ID: 1073187767

View in Genome Browser
Species Human (GRCh38)
Location 10:101626960-101626982
Sequence TGGGTGGGCCAGAATAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 1, 2: 1, 3: 58, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073187767_1073187774 5 Left 1073187767 10:101626960-101626982 CCTCCTCTATTCTGGCCCACCCA 0: 1
1: 1
2: 1
3: 58
4: 248
Right 1073187774 10:101626988-101627010 GGCCCTGATCATCTGCCACCAGG No data
1073187767_1073187777 8 Left 1073187767 10:101626960-101626982 CCTCCTCTATTCTGGCCCACCCA 0: 1
1: 1
2: 1
3: 58
4: 248
Right 1073187777 10:101626991-101627013 CCTGATCATCTGCCACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073187767 Original CRISPR TGGGTGGGCCAGAATAGAGG AGG (reversed) Intronic
900726317 1:4218633-4218655 TGGATGGGCCAGTCTAGAGGTGG + Intergenic
900965150 1:5952566-5952588 TGGGTGGGGCAGGGTAGGGGTGG - Intronic
900965160 1:5952586-5952608 TGGGTGGGGCAGGGTAGGGGTGG - Intronic
901589770 1:10331217-10331239 TGGGGTGCCCATAATAGAGGAGG + Intronic
901673424 1:10868914-10868936 TGCATGGGCCAGAAGAGAGGAGG + Intergenic
903135673 1:21307902-21307924 TGGGCAGGACAGAAGAGAGGAGG + Intronic
906249726 1:44301706-44301728 TGGGTGGGTCAGGGTAGTGGAGG - Intronic
906766619 1:48440102-48440124 TGGGTGGGGGAGATTAGAGGAGG - Intronic
907360066 1:53907048-53907070 CGGGTGGGCCAGAAATGAGAAGG + Intronic
909359474 1:74744096-74744118 TGGGAGGGGGAGATTAGAGGAGG + Intronic
910261725 1:85299521-85299543 AGGATGGGAAAGAATAGAGGGGG + Intergenic
911751353 1:101500985-101501007 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
912681504 1:111732082-111732104 TGGGAGGGCCAGGACAGTGGTGG + Intronic
913054405 1:115144185-115144207 TGAGTGTGCTAGAATAGGGGTGG + Intergenic
913382558 1:118227647-118227669 TTGGTGGGGGAGATTAGAGGAGG - Intergenic
915492558 1:156259249-156259271 TGGCTGGGCCAGCAGGGAGGTGG - Intronic
917279823 1:173369962-173369984 TGGGTGGAGGAGATTAGAGGAGG - Intergenic
917603071 1:176596810-176596832 GGGGTTGGACATAATAGAGGAGG + Intronic
920128351 1:203711778-203711800 TGGGTAGGACAGAAGTGAGGTGG + Intronic
921019640 1:211224299-211224321 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
922065253 1:222131311-222131333 TGGGAGGGCCAAAAAAGAGGGGG + Intergenic
923200512 1:231706355-231706377 TGGGTGGGGCAGAGAAAAGGTGG + Intronic
1062954495 10:1531158-1531180 TGCGTGGGACATAGTAGAGGGGG - Intronic
1063859147 10:10289607-10289629 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
1064603624 10:17016733-17016755 TGGGTGGGGGAGATTAGAGGAGG + Intronic
1065082352 10:22140908-22140930 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1065691113 10:28334941-28334963 TGTGTGGGTCAGAAATGAGGAGG + Intergenic
1066614629 10:37282520-37282542 TGGGTGGGGGTGATTAGAGGAGG + Intronic
1067089286 10:43258434-43258456 TGGGTTGGCCATGAAAGAGGAGG - Intronic
1067797812 10:49333485-49333507 TGTGTGGGTCAGAACAGATGGGG - Intergenic
1068583266 10:58766874-58766896 TCGGTGGGTCAAAAAAGAGGTGG - Intronic
1069365143 10:67688323-67688345 TGGGTGGGGGAGATTAGAGGAGG + Intronic
1070500904 10:77071588-77071610 TGGGTGGAACTGAATGGAGGTGG - Intronic
1073187767 10:101626960-101626982 TGGGTGGGCCAGAATAGAGGAGG - Intronic
1073452916 10:103620074-103620096 TGGGGGCGCCAGACAAGAGGAGG + Intronic
1073970699 10:109043383-109043405 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1074612983 10:115039156-115039178 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1074742699 10:116500333-116500355 TGGGAGGGGGAGATTAGAGGAGG + Intergenic
1075146280 10:119885626-119885648 TGGGTGGGGGAGATTAGAGGAGG - Intronic
1076731664 10:132442454-132442476 TGGGGGGGCCGGAATGGGGGGGG + Intergenic
1078063316 11:8061966-8061988 TGGGGGAGCGAGAACAGAGGAGG - Intronic
1078195725 11:9135112-9135134 GGGGTGGGCCAGGCTTGAGGGGG + Intronic
1078318210 11:10308986-10309008 GAGGTGTGCCAGAATTGAGGAGG + Intronic
1080724136 11:34878273-34878295 TGTTTGGGACAGAATAGAAGGGG - Intronic
1081033379 11:38113593-38113615 TGGGTGGGGGAGATTAGAGTAGG - Intergenic
1084482631 11:69430573-69430595 TGAGTGGGCCTGATTTGAGGTGG - Intergenic
1084566179 11:69930365-69930387 TGGGCTGGCCAGAAGAGATGAGG + Intergenic
1085227324 11:74933751-74933773 GGGGTGAGCCAGACTTGAGGTGG - Intronic
1087074954 11:94120283-94120305 TGGGTGGGGGAGATTAGAAGAGG - Intergenic
1087873351 11:103326431-103326453 TTTGTGGGCCAGCACAGAGGCGG - Intronic
1088507306 11:110539294-110539316 TGGGGGGGCCAGAAGGGAGATGG + Intergenic
1089401388 11:118166559-118166581 TGGGTGGGCAGGGGTAGAGGAGG - Exonic
1089911909 11:122109245-122109267 TGGGAGGGAAAGAAAAGAGGTGG + Intergenic
1091573958 12:1715073-1715095 TGGGTGGTGGAGATTAGAGGAGG + Intronic
1091760417 12:3083817-3083839 TGGGTTGGGCAGGATAGAAGAGG + Intronic
1092022093 12:5211096-5211118 TGGGTTGGCAAGAACCGAGGGGG + Intergenic
1092217839 12:6695095-6695117 GGGGTAGGCCAGAATAGAAGGGG + Intronic
1092768916 12:11878798-11878820 TGGCTGATCTAGAATAGAGGAGG + Intronic
1092919435 12:13217895-13217917 GGGGTGGGCCAGCAGAGAGCTGG + Exonic
1093509035 12:19904135-19904157 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1094017016 12:25875676-25875698 CAGGTGGACCAGAATAAAGGAGG - Intergenic
1095978184 12:47954099-47954121 TGGGTGGGCCTGGGCAGAGGGGG - Intergenic
1096235536 12:49923726-49923748 TGGGTGGGACAGAAGAGGAGAGG - Intergenic
1098271354 12:68773253-68773275 TGGGTGGGCCTTAATTCAGGAGG + Exonic
1099380245 12:81944164-81944186 TGTGTGGGCAAGAACAGATGGGG + Intergenic
1100092101 12:90984746-90984768 TGGGTGGAGGAGATTAGAGGAGG - Intronic
1101053719 12:100890723-100890745 TGGGAAGGTCATAATAGAGGAGG - Intronic
1101641221 12:106586843-106586865 TGCCTGGGCAAGAATGGAGGAGG - Intronic
1101704837 12:107211950-107211972 TGGGTGGGGAAGATTAGAGGAGG - Intergenic
1102053575 12:109880252-109880274 TCGGTGAGCCGGAATGGAGGGGG - Exonic
1103359692 12:120346380-120346402 TGGGTGGGACAGGCTTGAGGGGG - Intronic
1104306135 12:127612355-127612377 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1104609885 12:130219404-130219426 TGGGTGGGCCAGGAGAGCTGAGG + Intergenic
1104767054 12:131336955-131336977 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1105438627 13:20398015-20398037 AGGATGGGGCAGAATGGAGGGGG - Intergenic
1107805216 13:44147283-44147305 TGGGAGAGTCAGAAAAGAGGAGG - Intronic
1108277071 13:48821599-48821621 TGTGTAGGACAGATTAGAGGGGG + Intergenic
1108431129 13:50354947-50354969 CAGGTGAGCCAGAATAGATGTGG - Intronic
1109172876 13:59117960-59117982 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1109262623 13:60162306-60162328 TCTGTGGTCCAGAATACAGGAGG - Intronic
1110318713 13:74136017-74136039 TGGGTGGTCCAACCTAGAGGAGG + Intergenic
1110637223 13:77780315-77780337 TGGTGGGTCCAGAACAGAGGTGG - Intergenic
1111372486 13:87335616-87335638 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1113886002 13:113658643-113658665 TGGGTGACCCAGAATCGGGGCGG - Intergenic
1119854734 14:77891050-77891072 TGTGTGGGGCAGAGGAGAGGGGG + Intronic
1121098042 14:91231623-91231645 TGGGTTGGCCAGACAAGAGTGGG - Intergenic
1122630169 14:103104074-103104096 TGGGCGGGCCAGGCTGGAGGGGG + Intronic
1122920981 14:104880030-104880052 TGGGTGGGGCAGGACAGAGCAGG - Intronic
1124175806 15:27422956-27422978 TGTGTGGCCCAGGATAGGGGTGG - Intronic
1124497352 15:30194532-30194554 TGGCTGGGCCACAATGGCGGAGG + Intergenic
1124746220 15:32344115-32344137 TGGCTGGGCCAAAATGGGGGAGG - Intergenic
1125356769 15:38824771-38824793 TTGGCGGGCCAGAATCCAGGAGG + Intergenic
1126072117 15:44874317-44874339 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
1126086073 15:45012352-45012374 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1126468142 15:48979445-48979467 TGGGTGGGCCAGGAGAGACTGGG - Intergenic
1127309220 15:57737736-57737758 TGGGTGGGCCTGGAGTGAGGGGG + Intronic
1127957849 15:63868663-63868685 CAGTTGGTCCAGAATAGAGGGGG - Intergenic
1128328201 15:66738769-66738791 TGGGTGGGCTGAAATGGAGGAGG + Intronic
1128767883 15:70262157-70262179 TGGGTGGGCAAGGAGAGAGATGG - Intergenic
1128934950 15:71738287-71738309 TGGGTGGGCGAGATCAGTGGTGG - Intronic
1129966120 15:79737398-79737420 TGAGTAGGCCAGACTAGAGTAGG - Intergenic
1130682706 15:86010491-86010513 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1132764095 16:1525689-1525711 TGGGTGGCCCAGGATGGAAGGGG + Intronic
1135198305 16:20413337-20413359 TAGATGGGCCAGAATGGAGTTGG + Intronic
1135219929 16:20605221-20605243 TAGATGGGCCAGAATGGAGTTGG - Intergenic
1135220711 16:20612132-20612154 TGGGGAGGCCAGCAGAGAGGTGG + Intronic
1135940422 16:26817369-26817391 AGAGGGGGCCAGAGTAGAGGAGG - Intergenic
1137704803 16:50527078-50527100 GGGGTGGGTCAGGATGGAGGCGG + Intergenic
1137761910 16:50947994-50948016 TGGCTGGGGCAGAAAAGAAGAGG - Intergenic
1137969118 16:52966157-52966179 AGGGTGGGCCAGAATAGAAGGGG + Intergenic
1138128333 16:54456984-54457006 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
1138139561 16:54556637-54556659 TGGGTGGGGCAGAATTGATGGGG + Intergenic
1138514244 16:57527153-57527175 GGGGCTGGGCAGAATAGAGGAGG + Intronic
1139533978 16:67560479-67560501 TGGGTGATCCAGGAGAGAGGAGG - Intergenic
1141343833 16:83227558-83227580 TGGGCAGGCCAGAATCGAGATGG - Intronic
1141727707 16:85800329-85800351 TTGATGGGCCTGAATAGAGGAGG + Intronic
1143416382 17:6753953-6753975 TGGGTGGGACAGTCTATAGGAGG + Intergenic
1143687738 17:8532555-8532577 TTGGTGGGCAAGGATGGAGGTGG - Intronic
1145804055 17:27713908-27713930 TGGGTGGGGGAGGTTAGAGGAGG - Intergenic
1146453272 17:32991248-32991270 TGGGTGTGCAAGAACAGTGGTGG - Intronic
1148287370 17:46406413-46406435 TGGGTGGGATAGAGTAGATGTGG + Intergenic
1148309540 17:46623993-46624015 TGGGTGGGATAGAGTAGATGTGG + Intronic
1149073848 17:52575268-52575290 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1149209618 17:54288327-54288349 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1152799241 17:82323348-82323370 TGGGTGGGCCACAACAGGGCAGG - Intronic
1153969800 18:10215834-10215856 TGGCTGAGCCACATTAGAGGTGG + Intergenic
1155224976 18:23721472-23721494 TGTGTGGGCAAGACTAGAAGTGG + Intronic
1155476169 18:26237531-26237553 TGGGTGGGGGAGATTAGAGGAGG + Intronic
1155793826 18:30008455-30008477 TGAGGGAGCCCGAATAGAGGTGG - Intergenic
1157539442 18:48489415-48489437 TCAGTGGGTCAGAATAGAGCAGG - Intergenic
1157697224 18:49732584-49732606 TGGGTGGGCAGGAATGCAGGAGG - Intergenic
1158957276 18:62552003-62552025 TGGGTGGGGCTGAAAAGAAGGGG + Intronic
1160341163 18:78090031-78090053 TGGGTTGGGCAGAAAAGAGATGG - Intergenic
1161484801 19:4529726-4529748 GGGGCAGGCCAGATTAGAGGCGG - Exonic
1161598286 19:5163832-5163854 TGGGTGGGGGAGATTAGACGAGG + Intronic
1162237535 19:9320892-9320914 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
1163444880 19:17340503-17340525 GGGGTGGGGCAGAATGTAGGGGG - Intronic
1163513264 19:17748332-17748354 GGGATGGGGCAGATTAGAGGAGG - Intronic
1164157274 19:22604295-22604317 TGGGTTGGCCAGAATAGAGGAGG + Intergenic
1164455645 19:28404378-28404400 TGTGTGGCCCAGGATAGTGGGGG + Intergenic
1165291573 19:34890137-34890159 TAGGTGGGCCAGAAAAGACAGGG - Intergenic
1165293546 19:34907828-34907850 TAGGTGGGCCAGAAAAGACAGGG - Intergenic
1166118408 19:40669823-40669845 TGGGTAGCCCTGGATAGAGGAGG + Intronic
1166383605 19:42368602-42368624 TGGGGGGGCCAGGATGGGGGTGG + Exonic
1167593385 19:50415992-50416014 GGGAGGGGTCAGAATAGAGGGGG - Intronic
925274415 2:2638589-2638611 TGAGGGGACCAGAAGAGAGGAGG + Intergenic
925949950 2:8900614-8900636 TGAGTGGGGGAGATTAGAGGAGG + Intronic
927566624 2:24119179-24119201 TAGGTGGGGCAGGATAGGGGAGG - Intronic
927812419 2:26187466-26187488 TGTGAGGGCTTGAATAGAGGAGG - Exonic
928186227 2:29113912-29113934 TGGGTGGGTCAGACAAGAAGAGG + Intronic
930380464 2:50621660-50621682 GGGGTGGGCCAGGGTGGAGGAGG - Intronic
931103108 2:59024878-59024900 TGGTGGGGCCAGGAAAGAGGAGG - Intergenic
932615472 2:73228576-73228598 TGGGAGGGCATGAAGAGAGGTGG + Intronic
933759872 2:85665841-85665863 TGGGCCGGCCTGAATAGGGGTGG - Intronic
934867063 2:97823189-97823211 TGGGTGGGGGAAATTAGAGGAGG - Intronic
935135064 2:100292873-100292895 TGGGTGGTCCAAATGAGAGGGGG - Intronic
935813813 2:106827520-106827542 GGGGTGGGCGAGGATAGAAGAGG - Intronic
936102712 2:109597381-109597403 TGGGTGGTCAACAATAGAGCAGG - Intronic
936349487 2:111702123-111702145 TGGGTGAGAGAGAAGAGAGGAGG + Intergenic
938324989 2:130392412-130392434 TGGAAGGGCCAGGCTAGAGGAGG - Intergenic
939053500 2:137333860-137333882 GGGGTGGGGCAGCAAAGAGGAGG + Intronic
939523668 2:143264276-143264298 TTGCTGGGTCAGAATAGAGAAGG - Intronic
940360491 2:152791111-152791133 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
940860898 2:158769870-158769892 TTGGGGGGCAAGACTAGAGGGGG - Intergenic
941339934 2:164294546-164294568 TGGGAGGCCCAGGATACAGGAGG - Intergenic
943103134 2:183510853-183510875 TGGGTGGGGGAGATTAAAGGAGG + Intergenic
1168939571 20:1697161-1697183 TGGCTGGGCCAGATTAGAAGAGG + Intergenic
1170253746 20:14316803-14316825 TGTGTGGAACAGAATAGTGGTGG - Intronic
1171100206 20:22375691-22375713 TGGGTTAGCCAGAAAGGAGGTGG + Intergenic
1171430842 20:25082329-25082351 TGGGCTGGACAGAAGAGAGGAGG - Exonic
1172340590 20:34154521-34154543 TTGGTGGGGGAGATTAGAGGAGG - Intergenic
1172689874 20:36783009-36783031 TGGGTGGGCCAGAGGAGAAGAGG + Exonic
1173018564 20:39248285-39248307 TGGGGGGGCCACCAAAGAGGAGG + Intergenic
1173249616 20:41357676-41357698 TGGGTGGACCAGGATGGAGAGGG - Intronic
1174159550 20:48541205-48541227 TGGCTGGGAGAGAACAGAGGTGG - Intergenic
1176084746 20:63290836-63290858 TGGCTGGGTCAGAACAGAGCAGG - Intergenic
1176868545 21:14070346-14070368 TGGGTGGGTGAGGAAAGAGGGGG + Intergenic
1177264483 21:18765115-18765137 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1178342695 21:31799869-31799891 TGGGTGGGGCAGAAGAGGGAAGG + Intergenic
1179146526 21:38773307-38773329 TGGGTGGGAAAGACTGGAGGTGG - Intergenic
1180013357 21:45065633-45065655 GGGGTGGGCAAGCAGAGAGGGGG + Intergenic
1181349338 22:22244230-22244252 TCGGTGAGCCAGAACAGGGGTGG + Intergenic
1181531990 22:23522156-23522178 TGGGGGGCCCAGGATACAGGCGG - Intergenic
1182730098 22:32482053-32482075 TGTGTGGGACAGAATATATGAGG - Intronic
1182994712 22:34801486-34801508 TGGGGGAGCCAGAAAGGAGGTGG - Intergenic
1184369137 22:44071533-44071555 TGGGTAGCCCACAATGGAGGGGG - Intronic
949449030 3:4165429-4165451 TGGGTGGGGGAGATTAAAGGAGG + Intronic
949970395 3:9398182-9398204 TGGGTCGCCTAGATTAGAGGGGG - Intronic
950520166 3:13493340-13493362 TGGGTGGGGCGGACTAGTGGCGG - Intronic
950902796 3:16512958-16512980 TGGGTGGGGCAGGGTGGAGGCGG - Intronic
951020426 3:17776559-17776581 TGGGTGGGGGAGATTAGAGGAGG - Intronic
951239404 3:20271770-20271792 TGGGCGGGGGAGATTAGAGGAGG - Intergenic
952269759 3:31819201-31819223 TGGGTAGGCCAGAATGGGAGAGG - Intronic
952555111 3:34522214-34522236 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
953472345 3:43177922-43177944 TGGGTGAACCAGGGTAGAGGTGG + Intergenic
953977706 3:47394898-47394920 TGGGTTGTCCAGGACAGAGGTGG + Intronic
954577164 3:51682932-51682954 TGGGTTGGCCTGAGTAGAGGAGG + Intronic
954586922 3:51744412-51744434 TGGGTAGGGAAGATTAGAGGAGG - Intergenic
954598863 3:51852257-51852279 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955714106 3:61810623-61810645 TGGGTGGCCAAGAGTAGGGGTGG - Intronic
956357600 3:68411216-68411238 TGGGTGGGCCCAAGTAAAGGTGG + Intronic
961929462 3:130517471-130517493 GGGACCGGCCAGAATAGAGGAGG + Intergenic
965062681 3:163803678-163803700 TGGGTAGGGGAGATTAGAGGAGG - Intergenic
966258958 3:177952520-177952542 TGGGCAGGGCAGAAAAGAGGTGG - Intergenic
967095832 3:186176530-186176552 AGGGTTGGCCAGAATGGGGGAGG + Intronic
968862339 4:3182790-3182812 TGGGTTGACCAGAATGCAGGAGG - Intronic
969001885 4:3989189-3989211 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
969392186 4:6899073-6899095 TGGGTGGGAGACAATAAAGGTGG + Intergenic
969812034 4:9655622-9655644 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
972133374 4:35863097-35863119 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
978747110 4:112207550-112207572 TGGGTGGGGGAGATTAGAGAAGG - Intergenic
979400826 4:120247241-120247263 TGGGTGGGCCAGAGGAGAAGGGG + Intergenic
979414961 4:120425667-120425689 AGTATGGGCCAGAAGAGAGGGGG + Intergenic
979545846 4:121939162-121939184 TGGGTGGTGCAGTATAGAGTTGG + Intronic
982315111 4:154023985-154024007 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
982673737 4:158351523-158351545 TGGGAAAGCCAGAATATAGGGGG + Intronic
982877229 4:160664452-160664474 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
983145961 4:164215215-164215237 TGGGGGAGCCAGAAGAGAGATGG + Intronic
986094482 5:4541118-4541140 TGGGTGGGTGAGAATAGAGAAGG - Intergenic
986599300 5:9455613-9455635 TGAATGGGCCAGAACAGAGAAGG + Intronic
988360126 5:30226654-30226676 TGTGTGGGCCAAGGTAGAGGTGG - Intergenic
990367944 5:55089075-55089097 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
990560627 5:56980054-56980076 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
991294871 5:65070210-65070232 TGGTTGGGCCAGATTATAAGTGG + Intergenic
992455127 5:76909600-76909622 TGGGCGGGGGAGATTAGAGGAGG - Intronic
995706364 5:114992488-114992510 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
996721701 5:126636920-126636942 GGCGTGGGTCAGAAAAGAGGAGG - Intergenic
998914990 5:147003250-147003272 TGGGTGGGGGAGATTAGAGGAGG - Intronic
1002523236 5:179802713-179802735 TGGATGGGGCAGCACAGAGGTGG + Exonic
1005892891 6:30154341-30154363 AGTGTGGGCCAGAACACAGGTGG + Exonic
1007029948 6:38618511-38618533 TGGGTGGGGGAGATTAGAGGAGG - Intronic
1007178369 6:39911669-39911691 TGGGTGGGGCAGAAGTGGGGAGG - Intronic
1011233783 6:85192829-85192851 GGGGTGGGTCAGGCTAGAGGTGG - Intergenic
1013590311 6:111614188-111614210 AGGGTGGGTCAGATGAGAGGGGG + Intergenic
1016046294 6:139484014-139484036 TGGGTGGGCAAGAGGAGAGAGGG - Intergenic
1019136560 6:169912166-169912188 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
1019596536 7:1861001-1861023 GGGGCGGGCCAGGACAGAGGTGG - Intronic
1019717070 7:2543995-2544017 GGGGTGAGCCAGAATAGAGCTGG + Intronic
1019814767 7:3191432-3191454 TGGGGAGGCCAGACTAGAGCTGG + Intergenic
1022028817 7:26473116-26473138 TGGGTGGGCCAGGAGGAAGGAGG - Intergenic
1023078037 7:36502657-36502679 TGGGTGGGGGAGATTAGAGTAGG + Intergenic
1023866455 7:44240651-44240673 TGCGTGGGCCAGCAGGGAGGGGG + Intronic
1024870868 7:53960585-53960607 TGGGTGAGGGAGATTAGAGGAGG + Intergenic
1027791032 7:82639184-82639206 TGGGTGGGGGAGATTAGAAGAGG - Intergenic
1028095820 7:86759119-86759141 AGGACGGGGCAGAATAGAGGAGG - Intronic
1028495304 7:91454220-91454242 TGGGTGAGGGAGATTAGAGGAGG + Intergenic
1029388554 7:100259455-100259477 TGGGGGAGCTAGAATAGAAGCGG + Intronic
1029422121 7:100477280-100477302 TGGGTGCTCCAGAAGAGATGGGG - Exonic
1030420437 7:109301306-109301328 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1033244633 7:139707577-139707599 AGGGTGGGCCAGGACAGTGGGGG + Intronic
1033370013 7:140698750-140698772 TGTGGGGGCCGGATTAGAGGGGG + Intronic
1035331868 7:158101844-158101866 AGGGTGGGCCAGAATGAAGAAGG - Intronic
1036638185 8:10565511-10565533 CAGGTGGGCCAGAAGACAGGAGG - Intergenic
1037829733 8:22180301-22180323 TGGGTGAGCCAGAAGATGGGGGG + Intronic
1037856958 8:22378652-22378674 TGAGTGGGCCAGAACAAAGCTGG - Intronic
1037967423 8:23145395-23145417 TGGCTGGGCCTGAAGATAGGAGG + Intronic
1037980443 8:23249731-23249753 TGAGTGGGCCAGTTTAGAGGTGG - Intronic
1037987719 8:23300045-23300067 TGTGTGGGCCAGGAACGAGGGGG - Intronic
1038180714 8:25224813-25224835 AGGGTGGCCCAGAGCAGAGGTGG - Intronic
1038208338 8:25490806-25490828 AGGGTGGGGCAGAATACTGGAGG - Intronic
1038430873 8:27498296-27498318 TGAGTGGGGGAGATTAGAGGAGG + Intronic
1039275916 8:35934112-35934134 TGGGTGGGGAAGATTAGATGAGG - Intergenic
1039489033 8:37933890-37933912 AAAGTGGGCCAGAATAGATGGGG - Intergenic
1040527125 8:48235148-48235170 TGGGTGGGGAAGATTAGAGGAGG - Intergenic
1040796888 8:51297171-51297193 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
1041960586 8:63610956-63610978 TGGGTGTGGAGGAATAGAGGTGG + Intergenic
1042017300 8:64328116-64328138 TTGGTGGACCAGAATGGTGGGGG + Intergenic
1042771819 8:72390057-72390079 TGGGTCGGGGAGATTAGAGGAGG - Intergenic
1042919525 8:73908119-73908141 TGGGTGGGAGAGATTAGAGGAGG - Intergenic
1043256976 8:78149718-78149740 TGGGTGAGGGAGATTAGAGGAGG - Intergenic
1044005527 8:86932409-86932431 TGGGTGGGGGAGATTAGAGGAGG + Intronic
1044040561 8:87362996-87363018 TGGGTGGGGCGTACTAGAGGAGG - Intronic
1044277758 8:90322099-90322121 TGGCTGGTCCAGAATAAAGGAGG - Intergenic
1045002269 8:97888626-97888648 GAGCTGGGCCAGAAGAGAGGTGG + Intronic
1047990242 8:130278741-130278763 TGGGTGAAACAGAAGAGAGGGGG + Intronic
1048334898 8:133495216-133495238 TGTGTGGAAAAGAATAGAGGAGG - Intronic
1048465838 8:134664172-134664194 TGGGCTGGCCAGCAGAGAGGTGG - Intronic
1050099102 9:2099502-2099524 AGGGTGGGAAAGGATAGAGGAGG + Intronic
1055458373 9:76493640-76493662 TGGGCGGGGGAGATTAGAGGAGG + Intronic
1055620931 9:78124414-78124436 TGGCTGGGGAAGACTAGAGGTGG - Intergenic
1055810982 9:80147376-80147398 TGGGTGGGCAGGAAGGGAGGGGG + Intergenic
1056180785 9:84080298-84080320 TGGGTGAGACAGAGTAGAGTGGG + Intergenic
1056392874 9:86155170-86155192 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
1056485935 9:87058223-87058245 TGGGTGGGGAAGATTTGAGGAGG + Intergenic
1057747304 9:97762438-97762460 AGGTGGGGCCAGAATAGAGAGGG + Intergenic
1059490448 9:114662231-114662253 TGGCTGGGACAGAGTAGGGGTGG + Intergenic
1060801423 9:126547971-126547993 TGGGTGGGACAGCATCGGGGTGG - Intergenic
1061342686 9:129995777-129995799 TGGGTGGGGCAGAAGGGAAGTGG + Intronic
1062143187 9:134971511-134971533 AGGGTGGGCAAGAATAGAAGAGG + Intergenic
1186852343 X:13592869-13592891 TGGGGGGGCTAGAAAAGAAGGGG + Intronic
1187203841 X:17162112-17162134 TGGGTGAGTCAGAACAGAGTTGG + Intergenic
1188097430 X:26042218-26042240 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1192482858 X:71500089-71500111 TGGGTGGGGGAGATTAGAGGAGG + Intronic
1195552480 X:106184912-106184934 TGGGTGGGGGAGATTAGAGGAGG + Intronic
1200776135 Y:7171893-7171915 TGGGTGGAGGAGATTAGAGGAGG - Intergenic
1200801110 Y:7387765-7387787 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
1201403684 Y:13629913-13629935 TGGGTGGGGGAGATTAGAAGAGG - Intergenic
1201407597 Y:13664247-13664269 TGGGTGGGGGATATTAGAGGAGG + Intergenic
1201429606 Y:13891053-13891075 TGGGTGGGAGAGATTAGAGGAGG - Intergenic
1201516067 Y:14819606-14819628 TGGGTGGGGGAGACTAGAGGAGG + Intronic
1201530470 Y:14985566-14985588 TGTGTGGGGGAGATTAGAGGAGG - Intergenic
1201604635 Y:15771558-15771580 TGGGTGGGGGAGATTAGAGGAGG - Intergenic
1201648977 Y:16264798-16264820 TGGGTAGGGGAGATTAGAGGAGG + Intergenic
1201653832 Y:16320502-16320524 TGGGTAGGGGAGATTAGAGGAGG - Intergenic
1201729672 Y:17190542-17190564 TGGGTGGGGGAGATTAGAGGAGG + Intergenic
1201744072 Y:17351840-17351862 TGGATGGGGAAGATTAGAGGAGG + Intergenic
1201763058 Y:17559276-17559298 TGGGTGGGTGAGGAGAGAGGGGG + Intergenic
1201838494 Y:18346713-18346735 TGGGTGGGTGAGGAGAGAGGGGG - Intergenic