ID: 1073189772

View in Genome Browser
Species Human (GRCh38)
Location 10:101643071-101643093
Sequence GGCTCATGAGAGTCTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073189772_1073189776 21 Left 1073189772 10:101643071-101643093 CCAACAGGAGACTCTCATGAGCC 0: 1
1: 0
2: 0
3: 14
4: 195
Right 1073189776 10:101643115-101643137 AAGAAAGCATGTGTCCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073189772 Original CRISPR GGCTCATGAGAGTCTCCTGT TGG (reversed) Intronic
904577140 1:31512193-31512215 GGCTCACGTGATCCTCCTGTTGG - Intergenic
905366408 1:37453993-37454015 GCCTCTTGAGAGGCTCCTGGTGG - Intergenic
913196709 1:116462812-116462834 GGATCATGAGGGTATCGTGTTGG + Intergenic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
915532059 1:156508442-156508464 GGCTGATGGGAGATTCCTGTGGG - Intergenic
917977769 1:180251185-180251207 GGCGCATCAGAGCCTCCTGCCGG + Intronic
918261991 1:182804716-182804738 GGCTCTGGAGGGGCTCCTGTTGG - Intronic
918687769 1:187441215-187441237 GTCTTATGAGGCTCTCCTGTAGG + Intergenic
921708118 1:218346858-218346880 GGCTCAGGATAGTCTTCTGGGGG - Exonic
923269381 1:232341295-232341317 GTCTCATAACAGTGTCCTGTTGG - Intergenic
923545852 1:234922874-234922896 GGCTGAGGAGAGCCTCCAGTGGG - Intergenic
924644584 1:245866041-245866063 GGCACATGACAGTCTCCAGGGGG - Intronic
924880793 1:248159975-248159997 GGTGGATAAGAGTCTCCTGTGGG + Intergenic
1064851000 10:19708575-19708597 GGCTCAAGTGATTCTCCTGCCGG + Intronic
1071956496 10:90766422-90766444 AGCTCAAGTGAGTCTCTTGTAGG + Intronic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG + Intergenic
1075947363 10:126447281-126447303 AGCTAAAGTGAGTCTCCTGTAGG - Intronic
1076431938 10:130410166-130410188 GGCTCATGTGAGCCTCCCCTGGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077203177 11:1324020-1324042 GGCTAATGAGAGGCACCTGCAGG - Intergenic
1079055568 11:17203770-17203792 GGCTCAAGAGATCCTCCTGCTGG + Intronic
1080018385 11:27532023-27532045 GGCTCAAGTGATTCTCCAGTGGG - Intergenic
1081758081 11:45558874-45558896 GCCTCATGAGAGGCTCATGCTGG - Intergenic
1081805566 11:45888126-45888148 GGCTGAGGAGAGCCGCCTGTAGG + Intronic
1082779279 11:57273870-57273892 GGCTCATGATATTCTCTTGCTGG - Intergenic
1083359258 11:62094465-62094487 TGGTCATGAGAGTCTTCTTTGGG + Intergenic
1083360186 11:62101551-62101573 TGGTCATGAGAGTCTTCTCTGGG - Intergenic
1083729593 11:64645634-64645656 GGCTTATGAGTGTCTGCTCTGGG - Intronic
1084472392 11:69370685-69370707 GGCTCCTGACAGTTTCCTGTGGG + Intergenic
1085816775 11:79745741-79745763 GGTTCAAGAGAGTCAGCTGTAGG + Intergenic
1089106902 11:116017132-116017154 GGCTAAAGTGAGTCTCCTGTAGG + Intergenic
1091201682 11:133785307-133785329 AGGTGATGACAGTCTCCTGTGGG - Intergenic
1092699189 12:11208433-11208455 GGGCCATGAGAGTCTTCTCTGGG - Intergenic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1097187945 12:57205519-57205541 GGGTCATGAGAGTCCACAGTTGG - Intronic
1097940049 12:65294206-65294228 TGCTTATTAGTGTCTCCTGTTGG + Intronic
1102747093 12:115258712-115258734 GGCTCAAGTGAGTCCCATGTTGG - Intergenic
1103171710 12:118826147-118826169 TTCTCATGAGAGCCTCCTTTCGG + Intergenic
1103525010 12:121561722-121561744 GGCACATCAGAGTCACATGTAGG - Intronic
1103947475 12:124534575-124534597 GGCTCATGACAGGCTGTTGTCGG - Intronic
1105279364 13:18954303-18954325 GACTCAGGAGGGCCTCCTGTAGG - Intergenic
1106815389 13:33401811-33401833 AGAGCATGAGAGTCACCTGTGGG - Intergenic
1107635831 13:42391777-42391799 GGCTGCTGTGAGTCTTCTGTTGG + Intergenic
1107830313 13:44369531-44369553 GGCCAATGAGATTCTCCTTTTGG - Intergenic
1108726790 13:53191779-53191801 AGCCCATGAGAATATCCTGTTGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1117062924 14:51981280-51981302 AGCACATCAGAGTCACCTGTAGG + Intergenic
1118728530 14:68649984-68650006 GGCTCCTGAGAGCCACCTCTTGG + Intronic
1118965039 14:70573631-70573653 AGCTAAAGAGAGTCTCTTGTAGG - Intergenic
1119472641 14:74909366-74909388 GGCTCCTGGGAGTACCCTGTGGG - Intronic
1119615466 14:76096060-76096082 GGTTCATGAAAATCACCTGTGGG - Intergenic
1119727861 14:76933037-76933059 GGCTGATGAAAATCTCCTGGGGG - Intergenic
1121246006 14:92461188-92461210 GGCGCAGGAGAGAGTCCTGTTGG - Intronic
1122078421 14:99250329-99250351 GGTTCAAGAGATTCTCCTGCTGG - Intronic
1122693551 14:103542419-103542441 GGCTCGTGGGAGTCTCCTTGAGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202857160 14_GL000225v1_random:58698-58720 GGCACATGAAAGACCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1126611301 15:50532292-50532314 GGTTAATGAGTTTCTCCTGTGGG - Intronic
1129228814 15:74185090-74185112 GGGTCTGGAGAGTCTCCTGGAGG + Intronic
1131176429 15:90212191-90212213 GGCACATAAGAGTCACCTGCAGG - Intronic
1135198958 16:20420135-20420157 GGCCCCTGAGAGGCTCCTTTTGG - Intronic
1135219732 16:20603537-20603559 GGCCCCTGAGAGGCTCCTTTTGG + Intergenic
1140571522 16:76111957-76111979 GGCTCAAGTGTTTCTCCTGTTGG + Intergenic
1142865956 17:2791686-2791708 GGCATCTGTGAGTCTCCTGTGGG - Intronic
1144753803 17:17667751-17667773 GGCCCCTGAGAGTCATCTGTGGG - Intergenic
1148238143 17:45983066-45983088 GGCTCCTGAGGGCCTCCTGTTGG - Intronic
1150000667 17:61436487-61436509 AGCTAAAGTGAGTCTCCTGTAGG + Intergenic
1154338193 18:13482400-13482422 CGCTCATGGGAGTCAGCTGTGGG - Intronic
1157522397 18:48354385-48354407 TGCTCACAATAGTCTCCTGTTGG + Intronic
1161940964 19:7403766-7403788 GGCTCAAGAGATCCTCCTGCTGG + Intronic
1162408823 19:10492202-10492224 GGCTGATGAGGGTCACCAGTTGG + Exonic
1162902734 19:13805102-13805124 GGCTGATGAGATCCTCCTGCTGG + Exonic
1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG + Exonic
1164081001 19:21861298-21861320 GGAGCAGGAGGGTCTCCTGTTGG - Intergenic
1167220940 19:48197539-48197561 GGGTCAGGAGAGTCTCCAGCAGG + Exonic
927842824 2:26456284-26456306 GGCTCAGGCGTGTCTCCTGCAGG + Intronic
929841256 2:45466281-45466303 AGCTCCAGAGAGACTCCTGTGGG - Intronic
931077842 2:58736161-58736183 GGCTCCTGAGGGACTCCAGTGGG + Intergenic
931651273 2:64471128-64471150 GGCACATGAGCCTCTCCTGTAGG - Intergenic
935205390 2:100892463-100892485 CGCTCATGAGAGTCTTGTCTTGG + Intronic
935271639 2:101439807-101439829 GGTTCAAGCGATTCTCCTGTCGG + Intronic
936494885 2:113009820-113009842 GGTTTCTGAGAGTCTACTGTGGG + Intergenic
941843133 2:170108982-170109004 GGCCCATGACAGTGTCCTGGAGG + Intergenic
943019022 2:182550808-182550830 AGAGCATGAGAGTCTCCTGTTGG + Intergenic
945858326 2:215093081-215093103 GGAACAGGAGAGTGTCCTGTTGG - Intronic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1174123052 20:48281600-48281622 GACTGATGAGCGTCTCCTGGGGG - Intergenic
1175224800 20:57438999-57439021 GGCCTATGTGAGTCTCCTGCTGG + Intergenic
1175326555 20:58133144-58133166 GGCCCAGGAGAGTCCCCAGTGGG + Intergenic
1175481416 20:59313931-59313953 TGCTTATGAAAGTCTGCTGTGGG - Intronic
1176200062 20:63856048-63856070 TCCTCACGAGAGACTCCTGTGGG + Intergenic
1176335002 21:5588257-5588279 GGCGCAAGAGAGTCACCTGCGGG + Intergenic
1176392755 21:6232691-6232713 GGCGCAAGAGAGTCACCTGCGGG - Intergenic
1176468664 21:7083483-7083505 GGCGCAAGAGAGTCACCTGCGGG + Intronic
1176492225 21:7465261-7465283 GGCGCAAGAGAGTCACCTGCGGG + Intergenic
1176508417 21:7673122-7673144 GGCGCAAGAGAGTCACCTGCGGG - Intergenic
1179033599 21:37741356-37741378 GGCTCATGAGAGGTTCTGGTGGG + Intronic
1179106541 21:38405552-38405574 TGCTCATTAGAGTCACCTGGGGG - Intronic
1179451904 21:41473632-41473654 GGCTCCTGGGGGTCTCCTCTTGG + Intronic
1180001928 21:44998995-44999017 GGCTCCTGACAGATTCCTGTGGG - Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1181022898 22:20112833-20112855 GGCTAATCAGGGGCTCCTGTGGG + Intronic
1181030402 22:20146737-20146759 GGTTCCTGAGAGTCCCCTGTGGG - Intronic
1182501957 22:30754477-30754499 GGCTGAGGAGAGACTCATGTGGG + Intronic
1182830311 22:33299663-33299685 AGCTAATGATAGCCTCCTGTGGG - Intronic
1184695583 22:46137190-46137212 GGCTCACGGGAGGCTCCTGGCGG - Intergenic
1184810926 22:46831266-46831288 GTCTCTGTAGAGTCTCCTGTTGG + Intronic
949826415 3:8169983-8170005 GGATCATGAGTGTCTCAGGTTGG - Intergenic
950032045 3:9859877-9859899 GGCTCAGGGGAGTGTCCTGGTGG + Intergenic
951989355 3:28658608-28658630 AGCACAGGAGAGTCTCCTCTTGG - Intergenic
953882271 3:46696757-46696779 AGCTCCTGTGAGTTTCCTGTAGG - Intergenic
954413572 3:50381865-50381887 GACCCATGAGTGTCCCCTGTAGG - Intronic
957295682 3:78329761-78329783 GGCAAATGAGAGTCCACTGTTGG + Intergenic
957482233 3:80813258-80813280 GTCTGGTGAGAGTCTCCAGTTGG + Intergenic
962628353 3:137249875-137249897 GCCTCATGAGAATCTGCTGTGGG - Intergenic
962845442 3:139270126-139270148 CTCACATGAGAGTTTCCTGTGGG + Intronic
963065998 3:141265122-141265144 GGCCCAGGTGAGTCACCTGTAGG + Intronic
963849846 3:150200355-150200377 TCCTCATGGGAGGCTCCTGTGGG + Intergenic
964428813 3:156582157-156582179 GGCTCATCAGAATCACCTGTTGG + Intergenic
967883254 3:194316129-194316151 AGCTCATGGGAGTCGCCTGGAGG + Intergenic
968382206 4:106972-106994 GGCTCATGAAATTCTGTTGTAGG + Intergenic
971128341 4:23778757-23778779 GGTTCAAGAGATTCTCCTTTGGG + Intronic
976041992 4:80898018-80898040 GCCTCATGACAGTGTCCAGTGGG + Intronic
976213078 4:82691614-82691636 GGCCCATGAAAGTCACCTCTAGG - Intronic
976839597 4:89416383-89416405 GCCTCATGAAAGACTCATGTAGG - Intergenic
982553814 4:156835938-156835960 CTCTCCTCAGAGTCTCCTGTGGG + Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
989557963 5:42818837-42818859 TTCTCATCAGAGTCTCCTGCTGG - Intronic
992210340 5:74473269-74473291 GGCTCAGTAGAGTCCTCTGTGGG + Intergenic
992610642 5:78505369-78505391 GGCTTCTGAGATTCTCCTGGCGG - Intronic
994823098 5:104678813-104678835 GGATCGTGATAGTTTCCTGTTGG - Intergenic
996353856 5:122575547-122575569 GACTCATAAGAGTCAGCTGTGGG + Intergenic
998788392 5:145737872-145737894 GGCTCCTCACAGTCTCCAGTGGG - Intronic
999410299 5:151344398-151344420 GGCACATCTGGGTCTCCTGTAGG + Intronic
1000525393 5:162351591-162351613 GGATTATGATAGTTTCCTGTTGG + Intergenic
1002145724 5:177179649-177179671 TGCTCATGAGAGCCCCTTGTAGG - Intronic
1002603215 5:180366787-180366809 GGCTCAAGAGATTCTCATGCTGG + Intergenic
1007244429 6:40450337-40450359 GGCCCATCAGAGTCACATGTTGG + Intronic
1009759890 6:67991866-67991888 TCCTCAAGTGAGTCTCCTGTCGG - Intergenic
1009942961 6:70310464-70310486 GGTTCATGAGAGCCTACTGAAGG + Intergenic
1010985131 6:82414836-82414858 GGCTCATGACACTCTGCTGCTGG + Intergenic
1016438851 6:144063980-144064002 GGCACTTGAGATTCTCCCGTTGG + Intronic
1021078163 7:16330790-16330812 GGCTCACTAGAGTCTCCTCAGGG - Intronic
1022562304 7:31362493-31362515 TACTCATGAGAGTCCCCTGAGGG + Intergenic
1024277068 7:47686586-47686608 GGCTCAAGGGATTCTCCTGCTGG + Intergenic
1024767914 7:52683266-52683288 GCCTGATGAGATTCTCCAGTTGG + Intergenic
1027319678 7:77003881-77003903 GGCCCATCTGAGTCTCCTCTGGG - Intergenic
1027734307 7:81913361-81913383 GGCTAAAGTGAGTCTCTTGTAGG + Intergenic
1029241980 7:99169519-99169541 GGTTCAAGCGATTCTCCTGTCGG - Intergenic
1032443904 7:131963636-131963658 GGCTCAAGTGATCCTCCTGTAGG + Intergenic
1033358819 7:140623348-140623370 GTGTCATGACAGTCTCCTCTGGG - Intronic
1033433164 7:141307509-141307531 GTCTGATGGGAGCCTCCTGTTGG - Intronic
1034611358 7:152372493-152372515 AGCTAAAGAGAGTCTCTTGTAGG - Intronic
1035272518 7:157728834-157728856 GGCTCATGGAAGTCTCTTCTGGG - Intronic
1036226835 8:6966314-6966336 TACTCATGATATTCTCCTGTTGG + Intergenic
1040928064 8:52706471-52706493 GGTTCAAGAGATTCTCCTTTGGG + Intronic
1043658997 8:82710954-82710976 GCCTCAAGAAATTCTCCTGTCGG - Intergenic
1043725742 8:83608676-83608698 GGCTCAGTAGTGTGTCCTGTGGG - Intergenic
1045780019 8:105851615-105851637 GGGTTATGTGAGTCTCCTGAAGG - Intergenic
1047156493 8:122325237-122325259 TGCTCATGAGGGTTTCCTGGTGG - Intergenic
1049346543 8:142142270-142142292 AGCCCATCAGAGTCTCCTGTGGG - Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057810441 9:98253189-98253211 GGAACTTGAGAGTCTCCTGCAGG + Intronic
1061280087 9:129592994-129593016 GGTTGAAGAGAGTCCCCTGTGGG + Intergenic
1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG + Intronic
1062740360 9:138170396-138170418 GCCTCATTAGACTCTCCTTTTGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1186417007 X:9392672-9392694 GGCTTATTAGCGTGTCCTGTGGG - Intergenic
1190118062 X:47638601-47638623 TGCTCATCAGAATCACCTGTAGG - Intronic
1190512464 X:51186987-51187009 GGCTAAAGTGAGTCTCTTGTAGG - Intergenic
1190760170 X:53432101-53432123 TGCCCATGAGATTCACCTGTAGG + Exonic
1195965603 X:110427467-110427489 TGCTCATCAGAATCACCTGTAGG - Intronic
1196793317 X:119483215-119483237 GGATCCTGAGAGTCTCCTTTGGG - Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic