ID: 1073191807

View in Genome Browser
Species Human (GRCh38)
Location 10:101656656-101656678
Sequence TTGTTCTAAAAGCTGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073191799_1073191807 25 Left 1073191799 10:101656608-101656630 CCAGCCTGCTGTGAAAACCAAAA 0: 1
1: 0
2: 3
3: 63
4: 426
Right 1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG No data
1073191803_1073191807 -5 Left 1073191803 10:101656638-101656660 CCATGACTACCATGGCCATTGTT 0: 1
1: 0
2: 1
3: 19
4: 152
Right 1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG No data
1073191801_1073191807 8 Left 1073191801 10:101656625-101656647 CCAAAATACTATGCCATGACTAC 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG No data
1073191798_1073191807 26 Left 1073191798 10:101656607-101656629 CCCAGCCTGCTGTGAAAACCAAA 0: 1
1: 0
2: 3
3: 39
4: 348
Right 1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG No data
1073191800_1073191807 21 Left 1073191800 10:101656612-101656634 CCTGCTGTGAAAACCAAAATACT 0: 1
1: 0
2: 2
3: 26
4: 379
Right 1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073191807 Original CRISPR TTGTTCTAAAAGCTGGATTA TGG Intronic
No off target data available for this crispr