ID: 1073200101

View in Genome Browser
Species Human (GRCh38)
Location 10:101728304-101728326
Sequence CTGTGTTTATGGAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073200101_1073200107 12 Left 1073200101 10:101728304-101728326 CCCTCTGTCCTCCATAAACACAG No data
Right 1073200107 10:101728339-101728361 TCAGACAGCGGTAAATGCTATGG No data
1073200101_1073200108 29 Left 1073200101 10:101728304-101728326 CCCTCTGTCCTCCATAAACACAG No data
Right 1073200108 10:101728356-101728378 CTATGGTGAAATAGAAAATTTGG No data
1073200101_1073200106 0 Left 1073200101 10:101728304-101728326 CCCTCTGTCCTCCATAAACACAG No data
Right 1073200106 10:101728327-101728349 AGAATGGTGACTTCAGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073200101 Original CRISPR CTGTGTTTATGGAGGACAGA GGG (reversed) Intergenic
No off target data available for this crispr