ID: 1073206477

View in Genome Browser
Species Human (GRCh38)
Location 10:101772066-101772088
Sequence GAACCCAAAGTGGCAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073206477_1073206479 -7 Left 1073206477 10:101772066-101772088 CCTGTTTCTGCCACTTTGGGTTC 0: 1
1: 0
2: 1
3: 28
4: 241
Right 1073206479 10:101772082-101772104 TGGGTTCTAACTCACAGCTTTGG No data
1073206477_1073206484 21 Left 1073206477 10:101772066-101772088 CCTGTTTCTGCCACTTTGGGTTC 0: 1
1: 0
2: 1
3: 28
4: 241
Right 1073206484 10:101772110-101772132 CCCAGCCCCTCAACATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073206477 Original CRISPR GAACCCAAAGTGGCAGAAAC AGG (reversed) Intronic
900479658 1:2891870-2891892 CCACCCAAAGTGGCAGAGGCAGG - Intergenic
902541066 1:17155166-17155188 GAACCCACAGTGGAGGACACTGG - Intergenic
902765190 1:18609705-18609727 AAACTCAAAGTGGCAGAAACGGG + Intergenic
903618817 1:24682796-24682818 GAACCCAAAGTGTCTGAGACAGG - Intergenic
903685686 1:25130443-25130465 GAACCCAGAGTGGCTGGAGCAGG - Intergenic
903760379 1:25693785-25693807 GACTACAAAGTGGCAGAGACAGG - Intronic
906826317 1:48984337-48984359 GAACCCAATGTAGCAGAAAGAGG - Intronic
906977297 1:50589268-50589290 GAACCCACAGGGGCAGCAGCTGG + Intronic
907153835 1:52314119-52314141 GAACCCCAATTGCAAGAAACAGG + Intronic
907516477 1:54996432-54996454 CGACCCAACGTGGCAGAACCTGG - Intergenic
908366514 1:63429405-63429427 AAATCTAAAGAGGCAGAAACTGG - Intronic
908778209 1:67662429-67662451 GAGCGAAAAGTAGCAGAAACTGG + Intergenic
910138559 1:83999992-84000014 GAACCCAGCGTGACAGAAGCAGG - Intergenic
912467468 1:109883855-109883877 GAGCCCACAGTGTCAGAACCAGG + Intergenic
912716167 1:111985158-111985180 AACCCCAAAGTGGCAGAATAGGG + Intronic
916285542 1:163101068-163101090 GAACACAATGTCGCAGGAACAGG - Intergenic
918720050 1:187841213-187841235 GAACCCAAAGTGTCTGAGACAGG + Intergenic
920583703 1:207137260-207137282 GAACCCAAAATGTCTGAGACAGG + Intronic
920847156 1:209603676-209603698 GAAGCCACAGTGCCAGAAAAGGG - Intronic
921121100 1:212138498-212138520 GAAGCCAAAGTTGCAGAGAAAGG - Intergenic
921235795 1:213127723-213127745 AAACCCAAAGTGGCAGACAGAGG - Intronic
921682489 1:218050952-218050974 GAACCCAAAGTGGAACAGAGTGG + Intergenic
922449300 1:225723930-225723952 GAGCCCATAGTTGCAGAGACAGG - Intergenic
923336575 1:232976446-232976468 GAACTCAGAGTGGAAGAAAAGGG + Intronic
1065203780 10:23339077-23339099 GATCCTAAAGTTGCAGAGACAGG - Intronic
1070032976 10:72694707-72694729 GGAACAAAAGTGGCACAAACTGG - Intronic
1071139152 10:82486875-82486897 GAACCCACAGAAGCAGAAAGTGG + Intronic
1073206477 10:101772066-101772088 GAACCCAAAGTGGCAGAAACAGG - Intronic
1074074078 10:110104372-110104394 AAACACAAAGTGGCAAACACAGG - Intronic
1076056280 10:127375914-127375936 GACCCCAAAGTCAAAGAAACAGG + Intronic
1077246158 11:1539880-1539902 GACCCCAAAGTTGCAGAGAAGGG - Intergenic
1078005587 11:7529973-7529995 GCCCCCAAAGTGGCAGACCCTGG - Intronic
1079912460 11:26328460-26328482 TGACCCAAAGAGGCAGAAACAGG + Intronic
1080343411 11:31294897-31294919 AAAGCCAAAGAGGCAGAAAAGGG + Intronic
1080546863 11:33328738-33328760 TAACATAAAGTGGCAGAATCTGG + Intronic
1081471043 11:43371371-43371393 GAACCCAAAGAGGCAGCTATGGG - Intronic
1085315503 11:75542460-75542482 GTGCCCAAAGGGGCAGCAACAGG - Intergenic
1086736764 11:90316376-90316398 GAACCAAAAGTGGTAGCAATAGG + Intergenic
1087320592 11:96653172-96653194 AAAAACAAAGTTGCAGAAACAGG - Intergenic
1088013427 11:105031317-105031339 AAACACAAAGTGGAACAAACAGG - Intronic
1093964752 12:25312460-25312482 GAACACAATGTTGCAGGAACAGG - Intergenic
1094745781 12:33342722-33342744 GAACCCAAAGTATCTGAGACAGG + Intergenic
1095133284 12:38568226-38568248 GACCCCAGAGTTGTAGAAACAGG - Intergenic
1095243159 12:39884988-39885010 AAAACCATAGTGGCAGAGACAGG + Intronic
1096314833 12:50555363-50555385 GAATCCTAAGTGGCAAACACAGG - Intronic
1097419459 12:59356441-59356463 GAATCCACAGTTGCAGAAACAGG + Intergenic
1097733512 12:63155148-63155170 GAACCCAAAGTATCTGAGACAGG - Intergenic
1098284057 12:68890498-68890520 GAAACTTAAGTGGCAGAAACAGG + Intronic
1099832162 12:87857724-87857746 GTACCACAAGTGGCAGAAAAGGG + Intergenic
1100401920 12:94239061-94239083 GAACATAAAGAGTCAGAAACAGG - Intronic
1100413051 12:94341860-94341882 AAACCCAAAGCAGGAGAAACAGG + Intronic
1101157943 12:101945246-101945268 AAACCCTAAGTGGTAGAACCAGG + Intronic
1101294058 12:103402829-103402851 GGACCCAAGGTGGCAGAAATAGG + Intronic
1102264431 12:111470871-111470893 TAACCCAGAGTGGCAGAAGTGGG - Intronic
1103828101 12:123756476-123756498 GATCCCTCAGTGGCAGAACCAGG + Intronic
1104762808 12:131307473-131307495 GAAACCTAAGTGACAGGAACTGG - Intergenic
1104817117 12:131653910-131653932 GAAACCTAAGTGACAGGAACTGG + Intergenic
1105204184 13:18206342-18206364 GAACCCAAAGTTTCACAAAAGGG - Intergenic
1106078484 13:26481387-26481409 GGACCCAAAGGGGCACAGACAGG + Intergenic
1107939114 13:45368733-45368755 GAACCCAAAGTATCCGAGACAGG - Intergenic
1110065439 13:71099692-71099714 GAAAGAAAACTGGCAGAAACAGG + Intergenic
1113883120 13:113639880-113639902 GAACCCATAACGACAGAAACAGG - Intronic
1114411337 14:22503397-22503419 GAACCCAAAATGGCAGGCAGGGG + Intergenic
1114926142 14:27402278-27402300 GAACATAATGTTGCAGAAACAGG - Intergenic
1116091382 14:40311220-40311242 GAAACCAAAGTGGTAGATAGGGG + Intergenic
1116131144 14:40856548-40856570 GAAGCTGAAGTGGCAGAAACAGG + Intergenic
1117490662 14:56243439-56243461 GATCACAAAGTGCCAGGAACTGG - Intronic
1118895526 14:69942602-69942624 CAAACCAAAGTGACAGAAATTGG - Intronic
1120573182 14:86147383-86147405 TAAGCCAAAGTTGCAGAGACAGG + Intergenic
1121685298 14:95831160-95831182 GGACCCAAAGGGGCAGAGGCTGG + Intergenic
1123006164 14:105324891-105324913 GACCCAAAAGGGGCAGAAATGGG + Intronic
1123902025 15:24886938-24886960 CTACCCAAAGTGGCAGGAATGGG + Intronic
1123960413 15:25393098-25393120 GAAACCAAAGTGGGCAAAACTGG + Intronic
1127131843 15:55874269-55874291 GACCCCAAACAAGCAGAAACTGG + Intronic
1127174845 15:56342767-56342789 GTACCCAAAGTGGCAGCTCCTGG + Intronic
1128210863 15:65901196-65901218 GAACCCAAAGTGGGACAGATGGG - Intronic
1129110422 15:73334019-73334041 AAACCCAAAGTGGCTGAATGAGG + Intronic
1130866688 15:87939567-87939589 GACCCAAAAGTTGAAGAAACAGG + Intronic
1131537111 15:93246603-93246625 CACCCCAGAGTGGCAGAACCAGG + Intergenic
1131805343 15:96116154-96116176 GAAAACAAAGTGACAGAAACAGG + Intergenic
1135787171 16:25360580-25360602 AAATCCAAAATGGCAGCAACTGG + Intergenic
1137711525 16:50570289-50570311 GACCCCAAGGAGGCAGAAATTGG + Intronic
1138564536 16:57823488-57823510 GAACCCAAAGTATCTGAGACAGG - Intronic
1140597347 16:76431912-76431934 GAACTCAATGTGTCAAAAACAGG - Intronic
1141586389 16:85036370-85036392 GAATCCACAGAGTCAGAAACTGG - Intronic
1141943045 16:87291014-87291036 GAGCCCAAACGGGCAGAAATGGG + Intronic
1142566050 17:841033-841055 TTACCCAAAGTGGCAGAGCCGGG - Intronic
1143953390 17:10651367-10651389 GAGCCAAAAGAGGCAGAAAGGGG - Intronic
1144388334 17:14770673-14770695 GAGCCTAAAGTTGCAGGAACTGG + Intergenic
1144437868 17:15257581-15257603 GACCCTAAAGGGGGAGAAACCGG + Intronic
1147321695 17:39650459-39650481 AAACCCAAAATGGCAGACATGGG + Intronic
1147325319 17:39667169-39667191 GAACCCACGGTGGCAGGAGCTGG + Intergenic
1148408368 17:47441730-47441752 GAACCCCAAATATCAGAAACAGG + Intergenic
1148912100 17:50948333-50948355 GAAGCAAAAGTGGCAGTGACCGG + Intergenic
1149257590 17:54844223-54844245 AAATCCAAAGTGGCAGCAATAGG + Intergenic
1154968771 18:21386170-21386192 GAACCAAAAGTAGCTGATACAGG - Intronic
1156658532 18:39317315-39317337 AAAGCCAAAGAGACAGAAACTGG + Intergenic
1158382069 18:56942353-56942375 GATCCCCAACTGGCACAAACTGG - Intronic
1158454704 18:57595786-57595808 CAACCCAACGTGGAGGAAACTGG + Intergenic
1158543867 18:58379361-58379383 CAACCCTAAGTGGGAGAAATCGG - Intronic
1158782670 18:60669611-60669633 GGAGCCAAAGTTGCACAAACAGG - Intergenic
1159389338 18:67768802-67768824 GTACCCAAAGTTGCATAAATTGG - Intergenic
1161388529 19:4009373-4009395 AAACCCAAAGTGGCAGGCTCTGG + Intronic
1162405061 19:10468412-10468434 GAACCCAAAGTGGAAGGGAAAGG - Exonic
1165609508 19:37138416-37138438 GAACCCAAAGTATCTGAGACAGG - Intronic
925921140 2:8638758-8638780 CCACCCAAAGTGCTAGAAACAGG - Intergenic
927213640 2:20653554-20653576 GGACCCACAGAGGCAGAAAATGG - Intergenic
930161076 2:48156406-48156428 GGTCCCCAAGTGGCACAAACAGG - Intergenic
931689644 2:64824149-64824171 AGACTCAAAGTGGCAGAACCAGG - Intergenic
933600505 2:84324499-84324521 GAACCCTGAGTGTCAGAATCTGG - Intergenic
934045608 2:88170575-88170597 GAACCAAAGGTTCCAGAAACGGG - Intronic
934121331 2:88842961-88842983 AAACCCAAAGTCCCTGAAACAGG - Intergenic
935065040 2:99640013-99640035 AAAGACAATGTGGCAGAAACAGG + Intronic
935341530 2:102063735-102063757 GCAGCCAAAGTGACAGAATCAGG - Intergenic
935522139 2:104120954-104120976 GACACCCAAGAGGCAGAAACAGG - Intergenic
935736472 2:106110584-106110606 GAACCCCAAGTAGCAGCAAGAGG + Intronic
937517683 2:122673865-122673887 GTACCCAAAGAGGGACAAACTGG + Intergenic
937891446 2:126941962-126941984 GAACCCAAAATGTCTGAGACAGG - Intergenic
939829663 2:147056842-147056864 GACCCAAAAGTGGCAGATACAGG - Intergenic
940192969 2:151062015-151062037 CAGCCCCAAGTGGCAGAACCAGG + Intergenic
940647347 2:156405482-156405504 GGAGCCAAAGTTGGAGAAACAGG + Intergenic
940869248 2:158846521-158846543 GCACCCAAAGTGGCAAAGACTGG + Intronic
942757399 2:179358296-179358318 GACCCCAAAATGGCAGTAAGAGG + Intergenic
945561522 2:211346453-211346475 GTATCCAAGGTGGCAGAAAAAGG - Intergenic
946490862 2:220147606-220147628 GAACACCAAGTGTCAGCAACAGG + Intergenic
946621466 2:221568504-221568526 GAAACCAAAAGGGCAGAAAGGGG - Intronic
946862783 2:224015616-224015638 GAACCCAACCGGACAGAAACTGG + Intronic
947407852 2:229799453-229799475 CAAACTAAAATGGCAGAAACAGG + Intronic
1169648175 20:7837210-7837232 GAATCCCAAGGGGCAAAAACTGG + Intergenic
1170946750 20:20898105-20898127 GAACCCAAGGAGGCCAAAACCGG - Intergenic
1172075950 20:32297733-32297755 GAACCCCAAGTGGCAGCAATAGG - Intronic
1174358530 20:50014149-50014171 GAAACCACAGTGGCAGTAGCTGG - Intergenic
1175700138 20:61130936-61130958 AAACCCAGAGTGGGAGAAAGAGG + Intergenic
1175833042 20:61977518-61977540 GAACTGAAAGTGGCAGAACGGGG - Intronic
1176713792 21:10331740-10331762 GAACCCAAAGTTTCACAAAAGGG + Intergenic
1177480035 21:21674679-21674701 GAACCCATAGTAGAACAAACTGG - Intergenic
1178056186 21:28801062-28801084 GAACACACTGTGGAAGAAACAGG + Intergenic
1178870697 21:36372709-36372731 GAACCTAAAGGGTCAGAAACTGG - Intronic
1179075033 21:38113055-38113077 GAGCCCTAACTGGCAGGAACAGG + Intronic
1179499693 21:41800227-41800249 GAATCCCGAGTGGAAGAAACGGG - Intronic
1181857901 22:25795570-25795592 GATCTCAAAGTAGCAGAAAAAGG - Intronic
1184211517 22:43038606-43038628 AAAACCGAAGTGGTAGAAACAGG + Intergenic
1184724179 22:46333700-46333722 GAACCCAAAGTACCTGAGACAGG - Intronic
949396713 3:3622300-3622322 TCACCCAAAGTGGCAGAACCTGG + Intergenic
949627944 3:5888841-5888863 GTACCCAAAGGTGCAGAAACTGG + Intergenic
949779332 3:7668365-7668387 CCACCCACAGTGGCAGACACTGG + Intronic
949866966 3:8554525-8554547 GAACCCACAGTGGGTGGAACTGG - Intronic
950021349 3:9789852-9789874 GAAGCCCAAGAAGCAGAAACTGG - Exonic
951036503 3:17938693-17938715 CCACCCAAAGTGGCAGCAATCGG - Intronic
951405485 3:22291336-22291358 GAACTCATAGGGGCAGAAAATGG - Intronic
951492939 3:23292748-23292770 GAACAAAAAGAGGCACAAACAGG - Intronic
951842099 3:27045535-27045557 GAACCCAAAGTGTCTGAGACAGG + Intergenic
952225690 3:31373283-31373305 GAACCCAAAGTAGCGGAATCGGG - Intergenic
953346477 3:42179975-42179997 GAGCCCAAGGTGGGAGAATCAGG - Intronic
953776212 3:45819571-45819593 GAACCTGGACTGGCAGAAACTGG + Intergenic
955647586 3:61156500-61156522 GAACCCAAAGTCCCTGAGACAGG + Intronic
955762345 3:62300599-62300621 GAAACAAGAGTGGCAGAAGCAGG + Intergenic
957715312 3:83921823-83921845 CTATCCAAAGTTGCAGAAACAGG + Intergenic
957872476 3:86107421-86107443 GCACAGAAAGTGGGAGAAACAGG - Intergenic
959550583 3:107651335-107651357 GACTTCAAAGTGGAAGAAACAGG - Intronic
962917807 3:139921997-139922019 GAACACAAACAGGCAGAAAGAGG - Intergenic
963012093 3:140779954-140779976 GAACTCAAGGTGGAGGAAACAGG - Intergenic
965091598 3:164170142-164170164 GAACCCAAAGTATCTGAGACAGG + Intergenic
965236031 3:166124552-166124574 GAAACAAAAGTGTCAGAAAAGGG - Intergenic
967410912 3:189165766-189165788 GACCCCAAAGATGCAGAAAGGGG + Intronic
967411044 3:189166956-189166978 GACCCCAAAGATGCAGAAACGGG + Intronic
972277777 4:37573384-37573406 GTTCCCACAGTGGCAGAATCAGG + Intronic
975461801 4:74662148-74662170 GACCCCAAAGTGGCACTCACGGG - Intergenic
975498832 4:75062678-75062700 GAACCCAGAGTTGCAGAGAAGGG + Intergenic
976301097 4:83516305-83516327 GAGCACAAAGTTGCACAAACAGG + Intronic
976643082 4:87359781-87359803 CAAAACAAAGTGGCAGAATCAGG + Intronic
977205291 4:94158935-94158957 GAACATAATGTGGCAGGAACAGG - Intergenic
979488803 4:121300451-121300473 CAATCCAATGTGGCAAAAACTGG - Intergenic
980325653 4:131341816-131341838 CAAGCCAAAGAGGCAGAAAACGG + Intergenic
981435286 4:144713246-144713268 CAACACAAAGTGGCAGAGTCTGG + Intronic
982931962 4:161419819-161419841 GAACATAAAGTTGCAGAAATAGG - Intronic
983809795 4:172047153-172047175 GAGGCCAAAGTGGCAGCAATTGG - Intronic
985527502 5:414462-414484 GAACCCAAAGAAGCAAAAATGGG + Intronic
987831354 5:23099760-23099782 GAACTTAAAGTTGTAGAAACAGG + Intergenic
987970688 5:24940021-24940043 GAATCCAAAGTTGTAGAAATAGG - Intergenic
988054015 5:26069058-26069080 GTACCCACAGTGATAGAAACAGG + Intergenic
988990801 5:36668886-36668908 GAAACCAAAGTGGCAAACAAAGG - Intronic
991013579 5:61909362-61909384 GAACGCAATGTCACAGAAACAGG + Intergenic
992092178 5:73327011-73327033 GACTCCAAGGTGGCAGAATCAGG + Intergenic
992509981 5:77423049-77423071 GTACACACAGTGGCAGAAACTGG - Intronic
995846181 5:116496209-116496231 TAACCCAAAGTGGCAGCTGCAGG + Intronic
995852032 5:116556290-116556312 GAACATAAAGAGACAGAAACTGG + Intronic
999407082 5:151316173-151316195 GGGCCCCAAGTGGCAGCAACTGG - Exonic
1000114311 5:158138906-158138928 GAACCCAAAGAAGCAGGAAAGGG - Intergenic
1000780521 5:165474491-165474513 GATCCCATAGAGGAAGAAACTGG + Intergenic
1001437688 5:171713237-171713259 GAGCCCAGTGTGGCAGAAACTGG + Intergenic
1002163894 5:177332886-177332908 GGAGGCAGAGTGGCAGAAACAGG - Intronic
1003475157 6:6474909-6474931 GAACCCAAAATATCTGAAACAGG + Intergenic
1004651948 6:17618476-17618498 GAACCCAGAGGGGCATAAAAAGG + Intronic
1005641163 6:27797721-27797743 GAACCTAAAGTATCTGAAACAGG - Intergenic
1005869249 6:29961616-29961638 AAAATCAAAGTGCCAGAAACAGG - Intergenic
1006212458 6:32408419-32408441 AAAGCCCAACTGGCAGAAACTGG + Intergenic
1006299707 6:33187097-33187119 TCACCCAGAGTGGCAGAATCAGG + Intronic
1006658137 6:35614449-35614471 GAACCCAAAATGGAATATACAGG + Intronic
1007553199 6:42745923-42745945 GAAACAAAAGCGGCAGAACCAGG - Exonic
1008052342 6:46913133-46913155 GAAACCAGAGAGGCAGGAACAGG + Intronic
1013063019 6:106655858-106655880 GACCCAAAAGTGCCATAAACAGG - Intronic
1016147117 6:140691184-140691206 GAACGTAATGTGGCAGGAACAGG + Intergenic
1016902727 6:149118027-149118049 GTATCCACAGTGGCAGAAACAGG + Intergenic
1017558845 6:155605020-155605042 GAACCCAATGTCACAGGAACAGG + Intergenic
1018372660 6:163182240-163182262 GAACACAAATTTGCAGAAATGGG - Intronic
1019117469 6:169776825-169776847 GAACCCAAAGTATCTGAGACAGG + Intronic
1020260350 7:6527300-6527322 GGACTGAAGGTGGCAGAAACGGG - Intronic
1021150971 7:17150436-17150458 AAACCCAAAGTGGCATATTCAGG + Intergenic
1022630175 7:32077341-32077363 GGACACAAAGGGACAGAAACTGG + Intronic
1022637019 7:32145820-32145842 GCACACAAAGTGGCAGAGGCAGG + Intronic
1025871461 7:65438252-65438274 GAAGCCAAAGTGGCAGCAGGAGG + Intergenic
1026990754 7:74584015-74584037 AAACCAAAAGTGCCTGAAACAGG + Intronic
1027199402 7:76053702-76053724 GCAAACAAAGTGGCAGACACGGG - Intronic
1027412510 7:77935859-77935881 GAAACCAAAAAGCCAGAAACAGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029582730 7:101448078-101448100 GAGCCAAAAGTGGAAGAAACCGG - Intronic
1031455386 7:121972886-121972908 CAACCCAAAGTGCCACAAAATGG + Intronic
1031544490 7:123034892-123034914 GAACCCAGAATTGCAGGAACAGG - Intergenic
1031970781 7:128063401-128063423 GGACCCAGAGGGGCAGAAACTGG - Intronic
1035044690 7:155955987-155956009 AAACCCAACGTGGCAGCATCTGG + Intergenic
1035258282 7:157646057-157646079 AACCCCAAAGTAGCAGAACCAGG + Intronic
1035418394 7:158707598-158707620 GGAGCCAAAGTGGCTGTAACGGG - Intergenic
1035909679 8:3551979-3552001 GATCTCACAGTGGCAGAAACAGG + Intronic
1036218541 8:6901320-6901342 GAACCCAAAGTATTAGAGACGGG + Intergenic
1038401024 8:27284595-27284617 GATGCAAAAGTGGGAGAAACTGG + Intergenic
1038625699 8:29190792-29190814 GCACCCCAAGCGGCAGACACTGG - Intronic
1038717759 8:30007192-30007214 AAACCCAAAGTGTCTGAAACAGG - Intergenic
1039500707 8:38014584-38014606 GAACCCAAAATACCTGAAACAGG + Intergenic
1039953024 8:42186661-42186683 GAACCCAAAGTATCTGAGACAGG - Intronic
1040925449 8:52677353-52677375 GAACACGAAGTGGCAAAGACAGG + Intronic
1041755015 8:61304305-61304327 GAACCCAAGCAGGCAGAGACTGG - Intronic
1041835932 8:62215317-62215339 GAACCCAAAGTTTCACAAAAGGG - Intergenic
1043096875 8:75986390-75986412 CAACACAAAGTGAAAGAAACTGG + Intergenic
1044525908 8:93250863-93250885 GAACCAAAAGTGGGAAAAAGGGG + Intergenic
1045026648 8:98093280-98093302 GAAACCAAAGAAGAAGAAACAGG + Exonic
1047658802 8:127009735-127009757 GAAAACAAAGTTGCAGAAATAGG + Intergenic
1047808557 8:128383095-128383117 GGACACAAAGTGGCACAAAGAGG + Intergenic
1052221336 9:26026899-26026921 CAAGCCTAAGTGGCAGAAACTGG + Intergenic
1052301268 9:26955480-26955502 GAACTGAAAGTGACAGATACTGG - Intronic
1053428161 9:38024655-38024677 GAACCTCAAGTGGTAGAGACAGG + Intronic
1054818424 9:69497783-69497805 GAAACCAAAGTGGCGTAAAAGGG - Intronic
1058278756 9:103084150-103084172 GAACCCAAAGAGGCAGTTATTGG - Intergenic
1058445032 9:105047327-105047349 GAATCCATAGTGGGTGAAACAGG + Intergenic
1060989556 9:127840570-127840592 GAACACAGAGTAGCAGAACCTGG - Intronic
1061314030 9:129782969-129782991 AAACCCAAAGGGATAGAAACTGG + Intergenic
1185839631 X:3376560-3376582 CAACTCAAAGTGGCAGGAAGAGG - Intergenic
1187211608 X:17237651-17237673 AGCCCCAAAGTGGCAGAAGCAGG - Intergenic
1190604764 X:52129188-52129210 GAACCCAAAGTATCTGAGACAGG - Intergenic
1190908198 X:54748942-54748964 GGAGCCAGAGTGGCAGAATCAGG - Exonic
1191039870 X:56067871-56067893 GAGGCCAAAGTGGCAGTATCTGG + Intergenic
1192154419 X:68733195-68733217 GAAGGAAAAGGGGCAGAAACTGG - Intergenic
1192634661 X:72805925-72805947 GAAACCCAAGTGGCAGAGATGGG - Intronic
1192647052 X:72914876-72914898 GAAACCCAAGTGGCAGAGATGGG + Intronic
1192661376 X:73046266-73046288 GAACATAATGTGACAGAAACAGG + Intergenic
1194360743 X:92947509-92947531 AAACAAAAAGTGGCAGAAATTGG - Intergenic
1194584326 X:95714587-95714609 GAACCTAATGTCGCAGAAACAGG - Intergenic
1195566370 X:106344130-106344152 GAACCCAAAGTATCTGAGACAGG + Intergenic
1195897806 X:109765523-109765545 AAACCAAAAGTGGCAGGAAAAGG + Intergenic
1196122591 X:112066890-112066912 GAACTGAAAGTGACAGAAAGGGG - Intronic
1196393541 X:115234268-115234290 GTACCCAAAGCAGCAGAACCGGG - Intergenic
1199740693 X:150733618-150733640 GAGCACCAAGTGGCAGAACCTGG - Intronic
1199808454 X:151326181-151326203 GAACCCAAAGTAAAAGATACAGG + Intergenic
1199854450 X:151749114-151749136 GAAGAAAAAGTGGCAGAAAAGGG - Intergenic
1200183831 X:154168950-154168972 GAAGCTAGAGTGACAGAAACCGG + Intergenic
1200189485 X:154206078-154206100 GAAGCTAGAGTGACAGAAACCGG + Intergenic
1200195238 X:154243887-154243909 GAAGCTAGAGTGACAGAAACCGG + Intergenic
1200200890 X:154281008-154281030 GAAGCTAGAGTGACAGAAACCGG + Intronic
1200668943 Y:6063325-6063347 AAACAAAAAGTGGCAGAAATTGG - Intergenic
1200793190 Y:7317522-7317544 GACCCCACAGTGGGAAAAACAGG + Intergenic
1201934635 Y:19395392-19395414 CAACCCAAAGGAGAAGAAACTGG - Intergenic