ID: 1073206614

View in Genome Browser
Species Human (GRCh38)
Location 10:101772804-101772826
Sequence CTGCTGACTTGGGGCCAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073206614_1073206623 20 Left 1073206614 10:101772804-101772826 CCGGTTTGGCCCCAAGTCAGCAG 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1073206623 10:101772847-101772869 CCTGCCTGCCCACCTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073206614 Original CRISPR CTGCTGACTTGGGGCCAAAC CGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900397698 1:2459980-2460002 GTGCTCGCTTGGAGCCAAACAGG - Intronic
902946757 1:19846310-19846332 ATGCTGCCTTGGAGCCAAACTGG - Intergenic
904301208 1:29556058-29556080 ATGCTGACTTGCAGCCAAAACGG + Intergenic
906778735 1:48553221-48553243 CTGCTGAGCTGGGGCCCAGCTGG - Intronic
907158971 1:52357761-52357783 CTGGTGAGTTGGGGACAAGCAGG - Exonic
912952672 1:114131114-114131136 CTGCTGTCTTGGGGACATGCAGG - Intronic
918633690 1:186749191-186749213 CTGCACACTTGGTGCCTAACTGG + Intergenic
920195848 1:204226566-204226588 CTGCTTCCTTGTGGCCAGACTGG + Intronic
923521874 1:234741202-234741224 CTGCTGAACTGGAGTCAAACTGG + Intergenic
923566381 1:235079664-235079686 CTGCTGACTCAGGCCCAGACTGG - Intergenic
923779933 1:237013166-237013188 GTGCTGGCTCGGGTCCAAACAGG - Intergenic
924510778 1:244727730-244727752 CTGCTGAATTGGGGCCTTAGTGG + Intergenic
1063964820 10:11338725-11338747 TTCCTGCCTTGGGTCCAAACTGG - Intergenic
1065858072 10:29846782-29846804 CTGATGACATGGGGCCAAGGTGG + Intergenic
1068762722 10:60731685-60731707 CTGCTGACCTGGGCTCAAACCGG - Intronic
1073206614 10:101772804-101772826 CTGCTGACTTGGGGCCAAACCGG - Intronic
1073517493 10:104089975-104089997 CTGGTCACTTGGTGCCAATCTGG - Intergenic
1073801162 10:107043257-107043279 CTGAAGACATGGGGCAAAACGGG - Intronic
1074434698 10:113424182-113424204 TTGGTGACCTGGGGCCAAGCTGG - Intergenic
1076143252 10:128096365-128096387 CTGCTGACTTGGGGCAGCCCTGG + Intergenic
1077936088 11:6787373-6787395 TTGCAGACTTGGGCACAAACAGG - Intergenic
1086042430 11:82495384-82495406 CAGAGGACTTGGGGCCAAAGAGG - Intergenic
1089771153 11:120804081-120804103 CTGGTGACTTGTGGCTAAGCTGG + Intronic
1090401549 11:126452640-126452662 CTGATTACTTGGGGCCAAGCAGG - Intronic
1095852961 12:46831015-46831037 CTGCTGACTTGGAGGAAAAGGGG - Intronic
1096219791 12:49821894-49821916 CTCATGACTTGGGGCCAACTGGG + Intronic
1096587565 12:52632743-52632765 CTGCTGACTTGGAGGTTAACTGG + Intergenic
1097627766 12:62021711-62021733 ATGCTGCCTTGGGACCCAACTGG - Intronic
1101465363 12:104943627-104943649 CTGCTGAATTGGGGCATAATAGG - Intronic
1102585514 12:113920150-113920172 CAGCTGACTTCTGGCCAAGCAGG + Intronic
1103043344 12:117714377-117714399 CTGCTCCCTAGGGGGCAAACAGG - Intronic
1104065748 12:125304270-125304292 CTCCTGCTTTGTGGCCAAACAGG + Intronic
1105547977 13:21365660-21365682 CTGCTGGCCTGAGGCCACACAGG - Intergenic
1108684804 13:52809492-52809514 GTGGTCACCTGGGGCCAAACAGG + Intergenic
1115029202 14:28774450-28774472 CTGCTGAGTTGGGGCCGCCCTGG + Intronic
1117388118 14:55237087-55237109 CTGATGACATGGGCCCAAGCTGG + Intergenic
1119608390 14:76040955-76040977 CTGCTGACTTGGGCCCTTAGAGG - Intronic
1120790744 14:88579331-88579353 CTGCTGTTTGGGGACCAAACAGG - Intronic
1121482587 14:94290513-94290535 CTGAGGACTGGGGGCCAAGCCGG + Exonic
1122536986 14:102472227-102472249 CTGCAGCCATGGGGCCACACAGG + Intronic
1124593069 15:31070307-31070329 CAGGTGAGTTGGGCCCAAACAGG + Intronic
1127470345 15:59284319-59284341 CTCCTGAGTTGGGGGCAAATAGG - Intronic
1128249280 15:66153177-66153199 GAGCTCACTTGGAGCCAAACAGG + Intronic
1128648975 15:69396754-69396776 CAGCTGACTTGGGCCCAGCCTGG - Intronic
1129787059 15:78316492-78316514 CTGCTGCCTGGGGGACAAAAGGG + Intergenic
1130389985 15:83447058-83447080 CTTCTGTCTTGGTGCCGAACCGG - Intergenic
1130948243 15:88565651-88565673 AGGCTGACTTGGGTTCAAACAGG + Intergenic
1131335659 15:91546284-91546306 ATGCTGAGATGGTGCCAAACTGG + Intergenic
1136483161 16:30555349-30555371 CGGCTGACTTCTGGCCAAAGCGG + Exonic
1137618716 16:49861729-49861751 CTGCTGTCTTGTGGCCAGACAGG - Intergenic
1139356244 16:66368524-66368546 CTGCTGACTTGGGGACACCCAGG + Intronic
1140979542 16:80093623-80093645 CTGCTTTCTTGGGGCAAACCTGG - Intergenic
1141241128 16:82266232-82266254 CTGCTGACATGTGGCCAAGGTGG + Intergenic
1141903492 16:87007707-87007729 CTGCTTCCCTGGGGCCCAACTGG + Intergenic
1144564508 17:16348868-16348890 CTGCTGACTTGGGACCCCCCTGG - Intronic
1144961513 17:19046810-19046832 CTGCTGAGTTGGCCCCACACGGG - Intronic
1144973647 17:19127714-19127736 CTGCTGAGTTGGCCCCACACGGG + Intronic
1146180385 17:30694231-30694253 CGGCAGCCCTGGGGCCAAACTGG + Intergenic
1147807356 17:43141227-43141249 CTGCTCAATTGAGGACAAACTGG + Intergenic
1148169257 17:45505486-45505508 CTGCTCAATTGAGGACAAACTGG + Intergenic
1150400450 17:64851949-64851971 CTGCTCAATTGAGGACAAACTGG + Intergenic
1150649523 17:67000794-67000816 CTGCTGACTTGGAGCAGAAAGGG - Intronic
1151404048 17:73875398-73875420 CAGCAGACTTGGGGGCAAACAGG + Intergenic
1152554951 17:81048532-81048554 CTGCTGCCTTGTGCCCACACTGG + Intronic
1156700691 18:39820862-39820884 CTGCTGACCTTGGGCTGAACTGG + Intergenic
1157552307 18:48590229-48590251 CTGCTGCTCTGGGGCCACACTGG + Intronic
1157916083 18:51665110-51665132 AGGCAGACTTGGGACCAAACAGG - Intergenic
1160503392 18:79413523-79413545 CTGCTGGGTTGGGGCCACCCTGG + Intronic
1162218281 19:9154848-9154870 CTGCTGAGTTTGGGGCACACTGG - Intronic
1162978215 19:14221306-14221328 CGGCAGCCCTGGGGCCAAACTGG - Intergenic
1165112886 19:33512561-33512583 CTGCTCACTTGTGGCCAAGCGGG + Intronic
929410390 2:41692521-41692543 CTGCTGTCTTGGTTCCAATCTGG + Intergenic
932109392 2:68981592-68981614 TTGCTAACTTTGAGCCAAACAGG - Intergenic
937271361 2:120654968-120654990 CGGCTGGTTTGGGGCCAACCGGG + Intergenic
939020808 2:136956289-136956311 ATTCTCTCTTGGGGCCAAACTGG - Intronic
942374826 2:175326112-175326134 CTGCTGAATTGGGGCATAATAGG - Intergenic
948192980 2:236074193-236074215 ATGCTGACTTGTGGCCCAAATGG - Intronic
1168827604 20:824244-824266 CCTCAGACTTGGGGCTAAACCGG - Intergenic
1172135747 20:32685569-32685591 CCACTGACTTGGGGCCACTCTGG - Intergenic
1176710642 21:10146641-10146663 CTGCTGACTTGGGGTGAGCCAGG - Intergenic
1177297002 21:19188483-19188505 CAGTTGAGTTGGGGGCAAACAGG + Intergenic
1178244031 21:30935301-30935323 CTGCTGCAGTGGGGCCAGACAGG + Intergenic
1180079694 21:45481003-45481025 TTGCTGACTCGGGGCCACCCTGG + Intronic
1180833476 22:18918419-18918441 CTGGTGTTTTGGGGCCAAGCTGG - Exonic
1181066351 22:20307836-20307858 CTGGTGTTTTGGGGCCAAGCCGG + Intergenic
1184907436 22:47498300-47498322 CTGCTGAAATGGGGCTAATCAGG - Intergenic
1185388557 22:50547400-50547422 CCGCTGACCTGGGGCCCACCCGG + Intergenic
1203283561 22_KI270734v1_random:143717-143739 CTGGTGTTTTGGGGCCAAGCTGG - Intergenic
952629771 3:35452841-35452863 CAGCTGACTTTAGGCCAAAGTGG - Intergenic
954291259 3:49651176-49651198 CAGGTGCCTTGGGGCCACACAGG + Intronic
954316574 3:49804701-49804723 TTGCTGACTTGGTGCACAACTGG + Exonic
954321021 3:49832086-49832108 CTGGTTACTTGGGGCCACAGTGG + Intronic
956557985 3:70542629-70542651 CTCCTGACATGGGGGAAAACAGG + Intergenic
958846383 3:99269884-99269906 CTGCAGACTTGGGGCCACTTTGG - Intergenic
960277780 3:115746635-115746657 CTGCTGAATTGGGGCATAGCAGG - Intergenic
962284414 3:134074467-134074489 CTCCTAACTGGGGGACAAACAGG - Intronic
963783427 3:149509690-149509712 CTGATGAGATGGGGCCAAAGGGG + Intergenic
968067291 3:195765562-195765584 CATCTGACTTGGGTCCAAAGAGG - Intronic
970408573 4:15786676-15786698 CTGCTGACTTGGTGCACAATCGG - Intronic
971705053 4:30030729-30030751 CTGCTGACTTCGGGGAAAAGTGG + Intergenic
972415830 4:38839555-38839577 TGGCTGAGTTGGTGCCAAACTGG - Intronic
976808474 4:89074281-89074303 CTGCTGACTCTGGTCCAAGCTGG - Intronic
980892448 4:138830111-138830133 CTGTTTACGTGGGACCAAACTGG - Intergenic
985526627 5:406318-406340 CTCCTGACGTGGGGCCATTCTGG - Intronic
985588970 5:755123-755145 CTGCGCACTTGGGGCCTGACAGG - Intronic
985603650 5:847639-847661 CTGCGCACTTGGGGCCTGACAGG - Intronic
985695011 5:1335269-1335291 TGGCTGACCTGGGGCCACACAGG - Intronic
986725751 5:10595139-10595161 GTGCTGTGTTGGGGCCAGACCGG + Intronic
988446298 5:31289702-31289724 ATGGTGACTTGGGGACACACAGG + Intronic
990892733 5:60665608-60665630 CTGCTGAATTGGGGCGTAATAGG - Intronic
991408818 5:66327254-66327276 GAGCTGACTTGGAGCCCAACTGG - Intergenic
992176914 5:74158239-74158261 CTTCTGAATTGGGGCCAAGTGGG + Intergenic
995466090 5:112450635-112450657 CTGCTGAATTGGGGCGCAGCAGG - Intergenic
999074130 5:148779015-148779037 CTTCTGAGTTGGGGCCACTCAGG - Intergenic
1001148779 5:169208054-169208076 TTGCTTACCTGGGGGCAAACAGG + Intronic
1003166102 6:3679909-3679931 CTGCTGTCTTGAGGCCAAGAGGG - Intergenic
1003403536 6:5810096-5810118 CTGCTGGCCTGAGGCCACACAGG + Intergenic
1004237050 6:13883306-13883328 CTGCTGAATTGGGGCATAATAGG - Intergenic
1006510830 6:34520233-34520255 CGCCTGGCTTGGGGCCACACAGG - Intronic
1007612777 6:43161063-43161085 AGGCTGACTTGGACCCAAACTGG + Intronic
1014431511 6:121376397-121376419 CTGATGACTTGGGCCCAAGGTGG + Intergenic
1014485900 6:121998840-121998862 CTGGTGTCTTGGAGCCAGACAGG + Intergenic
1019031636 6:169018618-169018640 CAGCTGACTTAGGGCCCAAGTGG + Intergenic
1019181885 6:170192531-170192553 CTGCTCTCTTGGGACCACACAGG + Intergenic
1019680749 7:2347587-2347609 CAGATGATTTGGGGCCACACTGG + Intronic
1020016254 7:4833852-4833874 CTGCTCACTGGCGGCCACACTGG + Intronic
1022568910 7:31431916-31431938 CTGATGACTTGTGCCCAAAGTGG + Intergenic
1024622333 7:51172617-51172639 TTGCTGCCTTGTGGCCACACTGG - Intronic
1026866328 7:73826228-73826250 CTGGGGACTTGGGGCCAGGCGGG + Intronic
1032241144 7:130160245-130160267 CTACTGACTAGGAGCCTAACTGG - Intergenic
1035715918 8:1754848-1754870 CTGGTGCCCTGGGGTCAAACAGG + Intergenic
1038458384 8:27693989-27694011 CTGATGACTTGTGCCCAAAGTGG - Intergenic
1043376564 8:79656294-79656316 CTGCTGACTTGGGCAAGAACCGG + Intronic
1045649525 8:104329015-104329037 ATGCTGTCTTGGGGCAGAACTGG - Intergenic
1049468633 8:142765141-142765163 CTGCGGACATGGGGACAGACAGG + Intronic
1058342273 9:103912973-103912995 CTACTGACTTGAGGTCAAGCTGG - Intergenic
1060256391 9:122034798-122034820 CTGCTGACTTCAGGCCCTACTGG + Intronic
1062282224 9:135757141-135757163 ATGTTGCCCTGGGGCCAAACGGG - Exonic
1062380944 9:136286239-136286261 CTGGAGCCTTGGGGCCCAACTGG - Exonic
1062436501 9:136548722-136548744 CTGCTGACATTGGCCCAACCAGG + Intergenic
1202795402 9_KI270719v1_random:115629-115651 CTGCTGACTTGGGGTGAGCCAGG - Intergenic
1186006911 X:5082242-5082264 ATAATGACTTGTGGCCAAACAGG + Intergenic
1187928286 X:24270690-24270712 CTGCTGATTTGGGGGCTGACAGG + Intergenic