ID: 1073207296

View in Genome Browser
Species Human (GRCh38)
Location 10:101775920-101775942
Sequence GGCGTGACCCGCCGGGCTCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073207296_1073207304 0 Left 1073207296 10:101775920-101775942 CCGAGAGCCCGGCGGGTCACGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1073207304 10:101775943-101775965 GTCCCGCGGGCCGCCGCGGGAGG 0: 1
1: 0
2: 2
3: 19
4: 196
1073207296_1073207313 30 Left 1073207296 10:101775920-101775942 CCGAGAGCCCGGCGGGTCACGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1073207313 10:101775973-101775995 GAGCAGGGCGCGAGCGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 235
1073207296_1073207302 -3 Left 1073207296 10:101775920-101775942 CCGAGAGCCCGGCGGGTCACGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1073207302 10:101775940-101775962 GCCGTCCCGCGGGCCGCCGCGGG 0: 1
1: 0
2: 8
3: 20
4: 178
1073207296_1073207301 -4 Left 1073207296 10:101775920-101775942 CCGAGAGCCCGGCGGGTCACGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1073207301 10:101775939-101775961 CGCCGTCCCGCGGGCCGCCGCGG 0: 1
1: 0
2: 1
3: 32
4: 197
1073207296_1073207311 24 Left 1073207296 10:101775920-101775942 CCGAGAGCCCGGCGGGTCACGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1073207311 10:101775967-101775989 CGCGCTGAGCAGGGCGCGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 133
1073207296_1073207312 29 Left 1073207296 10:101775920-101775942 CCGAGAGCCCGGCGGGTCACGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1073207312 10:101775972-101775994 TGAGCAGGGCGCGAGCGGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 164
1073207296_1073207310 15 Left 1073207296 10:101775920-101775942 CCGAGAGCCCGGCGGGTCACGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1073207310 10:101775958-101775980 GCGGGAGGACGCGCTGAGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 160
1073207296_1073207309 14 Left 1073207296 10:101775920-101775942 CCGAGAGCCCGGCGGGTCACGCC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1073207309 10:101775957-101775979 CGCGGGAGGACGCGCTGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073207296 Original CRISPR GGCGTGACCCGCCGGGCTCT CGG (reversed) Exonic
900502373 1:3012701-3012723 CGCGGGACCCGCCTGGGTCTGGG + Intergenic
900645920 1:3708736-3708758 GGGGAGACCCGGAGGGCTCTTGG - Intronic
901040409 1:6359834-6359856 GGCTGCACCCGCCGGCCTCTGGG + Intronic
904644024 1:31952395-31952417 GGCGTGAGCCACCGGCCTCCAGG - Intergenic
911474186 1:98356187-98356209 GGCTTAACCCTCAGGGCTCTAGG - Intergenic
917760370 1:178150463-178150485 GGCGTGATCCACTGCGCTCTTGG + Intronic
919640256 1:200039343-200039365 GCCGTGAACCGCCGAGCTCCCGG - Intronic
921257752 1:213357565-213357587 GGTCTGACCAGCAGGGCTCTGGG + Intergenic
1064167673 10:13001110-13001132 GGAGTTACCGGCCTGGCTCTAGG + Intronic
1067145330 10:43689797-43689819 GGCTTGCCCGGCCGGGCTCTCGG - Intergenic
1067825281 10:49567577-49567599 GGTTTGACCCTCTGGGCTCTTGG + Intergenic
1070665136 10:78337342-78337364 GTCTTGACCCACCGAGCTCTGGG - Intergenic
1073207296 10:101775920-101775942 GGCGTGACCCGCCGGGCTCTCGG - Exonic
1077032000 11:472530-472552 GGTGAGACCCTCAGGGCTCTGGG + Intronic
1077664342 11:4094542-4094564 CGCCTGACCCAGCGGGCTCTAGG + Intergenic
1078358150 11:10648082-10648104 GGCGTGAGCCACCGGGCCCAGGG - Intronic
1079126460 11:17721327-17721349 GGCGGGCGCCGCAGGGCTCTCGG - Exonic
1083168418 11:60906404-60906426 GGCGCCACACGCCGGGCTCCGGG + Exonic
1083879227 11:65540005-65540027 GCCCTCACCGGCCGGGCTCTCGG + Exonic
1088626074 11:111731634-111731656 GGGGTGAGCCGCTGGTCTCTGGG + Intronic
1108643635 13:52406168-52406190 GGCGGGCCCCGCGGGGCTGTGGG - Intronic
1113104048 13:106753417-106753439 AGCGTGACCTGCCGTGCTCCCGG - Intergenic
1113708393 13:112448379-112448401 GCCGTGACCCCGCGGGCTCCCGG - Intergenic
1113874469 13:113585354-113585376 GGCGGGCGCCGCCGGGGTCTGGG + Intronic
1122231215 14:100307021-100307043 GGCCGAACCCGCCGGGTTCTGGG + Intergenic
1122290410 14:100677792-100677814 GGCTGCACCCGCCGTGCTCTGGG - Intergenic
1122883167 14:104699190-104699212 GGAGGGACCCCCGGGGCTCTTGG + Intronic
1122956023 14:105071688-105071710 GGCCTCACCCGCCATGCTCTGGG - Intergenic
1125522497 15:40356138-40356160 GGGGTGGCCCGCAGGGCCCTGGG - Exonic
1125522529 15:40356204-40356226 GGGGTGGCCCGCAGGGCCCTGGG - Exonic
1126851805 15:52801689-52801711 GGCCTGACCTGCCCGCCTCTGGG + Intergenic
1127753572 15:62068443-62068465 GGCGCCTCCGGCCGGGCTCTCGG - Exonic
1129162216 15:73753158-73753180 GCCCTGCCCCGCCGGGCTCCCGG + Intergenic
1130650628 15:85760277-85760299 GGGGTGACCCCCAGGGCACTCGG + Exonic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1134438870 16:14285750-14285772 GGCGCGCCCCGGCGGGCTCGGGG - Intergenic
1134881473 16:17748205-17748227 GGCGTGCACCGCAGGGCTCTTGG - Intergenic
1143524178 17:7462822-7462844 GGCACGTCCCGCTGGGCTCTCGG + Exonic
1144438992 17:15264773-15264795 GCCTTGGCCAGCCGGGCTCTGGG - Intronic
1145063632 17:19747682-19747704 GGTGTGAGGCGACGGGCTCTGGG - Intronic
1152755402 17:82085039-82085061 GGCGGTTCCCGCCGGGCTCTCGG + Exonic
1159289302 18:66395887-66395909 TGCGGGACCCGCCGGGCCCACGG - Intergenic
1160445580 18:78924857-78924879 GGCGTGAACCGCTAGCCTCTGGG - Intergenic
1162463366 19:10826425-10826447 GGCGTCACCCGCCTGGCCCCGGG + Intronic
1165487085 19:36102649-36102671 GGAGTGCCCCGCTGGGCTGTGGG + Intronic
1165559484 19:36666901-36666923 GGTGTGTTCCGCCGGGCTCCGGG + Intergenic
927212393 2:20646795-20646817 GGGGAGACGCGCTGGGCTCTAGG + Intronic
927567626 2:24126901-24126923 GGCGTGAGCCACCGGGCGCCCGG + Intronic
931780364 2:65574126-65574148 GGCGTGAGCCACCGGGCGCCTGG - Intergenic
947398924 2:229713923-229713945 GGCGGGGCCAGCCGGGCTCTCGG - Intronic
947800693 2:232927495-232927517 CGCGGGACCCGTCGGGCTGTCGG - Intronic
948120268 2:235524237-235524259 GGCGTGACCCTACTCGCTCTGGG - Intronic
948671179 2:239569866-239569888 GTCTTAACCCACCGGGCTCTGGG + Intergenic
1175937080 20:62518829-62518851 GGCGTGAACCGCGGGCCTCAAGG - Intergenic
1180355809 22:11838559-11838581 GCCGTGACCTCCTGGGCTCTGGG - Intergenic
1181307057 22:21922944-21922966 GGGGTGTCCCGACTGGCTCTGGG + Exonic
1182901496 22:33902251-33902273 GGCGTGCCCAGCAGAGCTCTTGG + Intronic
949997014 3:9626152-9626174 GGCTTAGCCCGCAGGGCTCTTGG + Intergenic
950912119 3:16605426-16605448 GGCGTGGTCCGCGGGGCTCAGGG + Intronic
953657047 3:44862191-44862213 TGCGGGGCCCGCGGGGCTCTTGG + Intronic
960556314 3:119034646-119034668 GGCGTGAGTCTCCGCGCTCTTGG + Exonic
961181044 3:124877742-124877764 GGTGTGACCTGCTGAGCTCTAGG + Intronic
962200897 3:133400297-133400319 CGTGTGACCCGCCGGGCCCTCGG + Exonic
973581494 4:52348626-52348648 GGGGTTACCCTCCTGGCTCTTGG - Intergenic
977326902 4:95585160-95585182 GGCATGAGCCACCGTGCTCTGGG + Intergenic
985537529 5:473462-473484 GGCGAGAGCCGCCGGGCTCGGGG - Intronic
985757598 5:1728329-1728351 GGGGTGACCCCACGGGCTCTTGG + Intergenic
995874692 5:116778181-116778203 GGAGTGACCCGGCTGGCTGTGGG - Intergenic
997714059 5:136029111-136029133 GGCGGGACCCGCCAGGGTCGCGG - Exonic
998364650 5:141621371-141621393 GGGGTGACCCCCAGGACTCTAGG + Exonic
999198960 5:149802585-149802607 GCTGTTACCTGCCGGGCTCTGGG + Intronic
999223501 5:150000829-150000851 GGCTTGACCCCCGGGGCCCTCGG + Exonic
1000279900 5:159773419-159773441 GGCGGCAGCAGCCGGGCTCTCGG + Intergenic
1003074432 6:2971210-2971232 GGCGTCACCGGCCGGGCTCGCGG + Intronic
1004399746 6:15277401-15277423 GGCATGAGCCACCGTGCTCTTGG + Intronic
1011549195 6:88513892-88513914 GGCTTCACCCTCTGGGCTCTTGG + Intergenic
1015451321 6:133370059-133370081 GGCGTGAACCTTCGGGCTCCAGG - Intronic
1018862755 6:167722899-167722921 GGAGTGACCCACCGGGACCTGGG + Intergenic
1019450908 7:1097334-1097356 GGTGTCACCCGACGTGCTCTTGG - Intronic
1019676297 7:2314498-2314520 GGCGTGACCAGGCGGGGTGTGGG - Intronic
1020130434 7:5556164-5556186 GGCTCCACCCGCCTGGCTCTGGG + Intronic
1020262734 7:6539731-6539753 GGAGTGGCCCGCAGGCCTCTCGG + Exonic
1022077997 7:26992421-26992443 GGCGTGAGCCACCGAGATCTCGG + Intronic
1025237403 7:57244151-57244173 GGCATCACACGCCGGGCTATAGG - Intergenic
1028582933 7:92425485-92425507 GGCTTGACCCGCCTGACTCCTGG + Intergenic
1031899187 7:127391919-127391941 GGCGGGCACCGCCGGGCTCCGGG + Intronic
1033756465 7:144401175-144401197 GGCCTGACCCACAGGGCACTGGG + Exonic
1034218070 7:149422930-149422952 GACGGGACCCGCTGAGCTCTGGG + Intergenic
1035205535 7:157291803-157291825 GGTGTTACCAGCTGGGCTCTGGG + Intergenic
1036708221 8:11060439-11060461 GGCGCCACCCGCCGGGAACTAGG + Intronic
1036999914 8:13705680-13705702 GGGGTGACCCGCCAGGCCCAGGG - Intergenic
1042514999 8:69650076-69650098 GGCTTGACCCCCCAGGCTCAAGG + Intronic
1042837892 8:73093450-73093472 GGCCTCCCCCGCCGGGCTCCTGG - Intronic
1045971541 8:108083857-108083879 GGGGTGAGCAGCCGGGTTCTGGG - Intergenic
1049090722 8:140511690-140511712 GCCCCGCCCCGCCGGGCTCTGGG + Intronic
1049109416 8:140634396-140634418 CGCAGGCCCCGCCGGGCTCTGGG - Intronic
1057447544 9:95127838-95127860 TGCTGGACCCGCCGGGCTCCAGG + Intronic
1061959648 9:133981512-133981534 GGAGTGAGCCGCCGGGCTCGGGG + Intronic
1187419567 X:19122596-19122618 GGCGTGGCGCGTCGGGCGCTCGG + Intronic