ID: 1073207567

View in Genome Browser
Species Human (GRCh38)
Location 10:101776718-101776740
Sequence CGGGGCACGCGGCCGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073207567_1073207579 24 Left 1073207567 10:101776718-101776740 CCCTGTTTCGGCCGCGTGCCCCG No data
Right 1073207579 10:101776765-101776787 TCACTCTCCCGAGGAGGCCCTGG No data
1073207567_1073207577 18 Left 1073207567 10:101776718-101776740 CCCTGTTTCGGCCGCGTGCCCCG No data
Right 1073207577 10:101776759-101776781 TCTCCTTCACTCTCCCGAGGAGG No data
1073207567_1073207576 15 Left 1073207567 10:101776718-101776740 CCCTGTTTCGGCCGCGTGCCCCG No data
Right 1073207576 10:101776756-101776778 CAGTCTCCTTCACTCTCCCGAGG No data
1073207567_1073207580 25 Left 1073207567 10:101776718-101776740 CCCTGTTTCGGCCGCGTGCCCCG No data
Right 1073207580 10:101776766-101776788 CACTCTCCCGAGGAGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073207567 Original CRISPR CGGGGCACGCGGCCGAAACA GGG (reversed) Intronic