ID: 1073207847

View in Genome Browser
Species Human (GRCh38)
Location 10:101778123-101778145
Sequence CCTACTGTGTACAAGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073207847_1073207853 26 Left 1073207847 10:101778123-101778145 CCCTCATCCTTGTACACAGTAGG 0: 1
1: 0
2: 1
3: 17
4: 138
Right 1073207853 10:101778172-101778194 TCGATGAACAAATGATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073207847 Original CRISPR CCTACTGTGTACAAGGATGA GGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900620855 1:3586985-3587007 CCACCTGTGTGCAAGGAGGAAGG + Intronic
902391062 1:16106787-16106809 CAGACAGTGTACAGGGATGAGGG + Intergenic
906244002 1:44260477-44260499 CCTTCTGGTTACAAAGATGAAGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907640415 1:56183456-56183478 CCTAATGTTGACAAGGATGTGGG + Intergenic
912936234 1:114005771-114005793 CCTACTATGTGCCAGGCTGAAGG - Intergenic
912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG + Intergenic
913581463 1:120231743-120231765 CCTACTTTGTACTAGTATGTAGG + Intergenic
913626713 1:120666645-120666667 CCTACTTTGTACTAGTATGTAGG - Intergenic
914563395 1:148843189-148843211 CCTACTTTGTACTAGTATGTAGG + Intronic
914609432 1:149287034-149287056 CCTACTTTGTACTAGTATGTAGG - Intergenic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
916243429 1:162662258-162662280 CCTATTGTGTAACAGGATGCAGG + Intronic
916312510 1:163412614-163412636 CCAACTCTGGACAAGGAGGAAGG + Intergenic
916659124 1:166904864-166904886 CCTACTGTGTACAGTGAAGTGGG - Intergenic
917103525 1:171469575-171469597 CCTACTGAGTTCCAGGATGCAGG - Intergenic
918180856 1:182085221-182085243 CCTACTGTGTGCAAGGCAGCTGG - Intergenic
919467281 1:197937499-197937521 CATTCTGTGTACAAGAAAGAGGG + Intergenic
920664817 1:207955341-207955363 CTTACTGTATACAAGGATTATGG + Intergenic
921007318 1:211107314-211107336 CCTATTGTGTACAGCAATGATGG - Exonic
921172015 1:212558701-212558723 CCGACTGTGTCCAAGGCCGAGGG + Intergenic
923522153 1:234743639-234743661 CCCACTGTGTACCAGGCTGAGGG - Intergenic
1062873197 10:924594-924616 ACTAGTGTGAACAAGGCTGAAGG - Intronic
1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG + Intronic
1063988011 10:11528161-11528183 CCTAATGTTAATAAGGATGAAGG - Intronic
1064270589 10:13861748-13861770 CTTACTCTGTGCAAGGTTGATGG - Intronic
1072926891 10:99623621-99623643 CCTACTGTGTACCTGGAAGGAGG - Intergenic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1073507396 10:104010794-104010816 CCTACAGTGTATAAGCATGCAGG - Exonic
1073574145 10:104607745-104607767 CCTACTGTGAACTAGGACCATGG + Intergenic
1075907429 10:126093768-126093790 CATGGTGTGTACAAGGAAGAGGG - Intronic
1076722688 10:132399630-132399652 CCTACTGTGTGCCAGGAAGTGGG + Intronic
1078607579 11:12790413-12790435 CCTACTGTGTCCAAGGGATATGG - Intronic
1079724839 11:23867970-23867992 CCTACTGTGTTCAGAGATGACGG - Intergenic
1090547917 11:127785476-127785498 CCTTCTGGGTAAAATGATGATGG + Intergenic
1090698201 11:129269864-129269886 CCAAATGTGGACAAGGATGTGGG + Intronic
1091805768 12:3354865-3354887 ACTGCTGTGTACAGGGGTGAAGG + Intergenic
1091826715 12:3518281-3518303 CCTGCTGTTTACAAGGAAGAGGG - Intronic
1102232015 12:111269252-111269274 CCTACTGTGTACCAGGTTCTGGG - Intronic
1103252336 12:119511054-119511076 CCTACTGTGTGCTAGGATGAAGG - Intronic
1105911170 13:24869275-24869297 CTTACTGTGTAAAAGGCTGAAGG - Intronic
1108037328 13:46305184-46305206 CCAACAGTGTACAAGGGTCATGG - Intergenic
1109217249 13:59603654-59603676 TCTACTGTGGACAATGATGATGG + Intergenic
1109801859 13:67390438-67390460 CCATCTGGGTTCAAGGATGATGG - Intergenic
1111294751 13:86264156-86264178 CCTTGTGTGTGGAAGGATGAGGG + Intergenic
1113724297 13:112587308-112587330 CCTACTGTTTAAAGGGTTGAAGG - Intronic
1117393100 14:55281435-55281457 CCAACTGTGTATAAGATTGAAGG - Intronic
1119193273 14:72698974-72698996 GCAACTGGGTAGAAGGATGAAGG + Intronic
1119937858 14:78609377-78609399 CTTACTGTTTAGGAGGATGATGG + Intronic
1126865676 15:52934248-52934270 GCTACTGTGTCCAAGGAGGATGG + Intergenic
1129618777 15:77123559-77123581 CCCACTGTGTAGAATGGTGAAGG + Intronic
1129960091 15:79676223-79676245 CCTATTGAGTACAGGAATGAAGG + Intergenic
1130423731 15:83774745-83774767 CATGCTGTGTAGAAGAATGATGG + Intronic
1135123996 16:19791583-19791605 CCTTGTGTGTGGAAGGATGAGGG - Intronic
1135732619 16:24907331-24907353 CCTACTGTGTACCAGGCACAGGG + Intronic
1136297495 16:29312013-29312035 CCAACTGTGTGCAAGGATATCGG + Intergenic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1140139436 16:72241219-72241241 CCTGCTGTATAAAAGCATGAGGG - Intergenic
1142059049 16:88018090-88018112 CCAACTGTGTGCAAGGATATCGG + Intronic
1146469680 17:33114005-33114027 CCTACTATGTGCAAGGATTATGG + Intronic
1150151480 17:62812474-62812496 CATGCTGTGTGCATGGATGAAGG - Intergenic
1152421600 17:80196208-80196230 CCTACTGTGTGCAAGGCCCAAGG - Intronic
1153087634 18:1306518-1306540 CCTAATGTTTACAAGTAAGAAGG + Intergenic
1153193425 18:2568221-2568243 CTTACTGAGTGCAGGGATGAAGG + Intronic
1155373565 18:25131657-25131679 CCTACTATGTACAAGGCTCTGGG - Intronic
1155725389 18:29075359-29075381 CCCACTGTGAACTAGGAGGAGGG - Intergenic
1155919950 18:31593599-31593621 CCTACTGTGTGCAAGGCTGGGGG + Intronic
1156271411 18:35536527-35536549 CCTACTGAATGCAGGGATGATGG - Intergenic
1156544457 18:37949823-37949845 CCTAGTGATTCCAAGGATGAAGG - Intergenic
1157934548 18:51858659-51858681 CCTGCTCTGTACAAGACTGAAGG + Intergenic
1159624435 18:70675573-70675595 CCTACTGGGTACCAAGATGGTGG - Intergenic
1159987711 18:74863769-74863791 CCTACTGTATGTAAGCATGATGG + Intronic
1163728071 19:18933598-18933620 CCTGCTGTGTACCAGGCCGAGGG - Intronic
1165188296 19:34040507-34040529 CCTACTTACTACATGGATGACGG - Intergenic
1166333790 19:42093357-42093379 CCTACCGTGTCCCAGGAAGAGGG + Intronic
927131718 2:20065875-20065897 CCTACTGGGTGCACAGATGATGG + Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
929032050 2:37658391-37658413 ACTACTGTGCACAAGGAATATGG - Intronic
930376423 2:50572828-50572850 CCTACTAGGTACTAGAATGAGGG + Intronic
931696932 2:64878182-64878204 CCTTTTGTGTGCAAGGATTAAGG + Intergenic
932573929 2:72952459-72952481 CCTACTGTGCACAAGGCATAGGG - Intronic
937970091 2:127542558-127542580 CATACTATGGATAAGGATGAAGG + Intronic
937996905 2:127701281-127701303 CCTACTCCGAACAAGGAAGAGGG + Exonic
942499693 2:176576357-176576379 CCAAGTGTTTGCAAGGATGAGGG + Intergenic
943762267 2:191622700-191622722 CCTGCTGTGTACATGCATTATGG + Intergenic
944723103 2:202443425-202443447 CCAACAGTGTACAAGGGTCAAGG + Intronic
944900522 2:204209574-204209596 CCAAATGTGGACAAGGATGTGGG - Intergenic
1170746265 20:19101671-19101693 CCTACTGTGTGCAAGGCTCTTGG - Intergenic
1172628684 20:36363832-36363854 CCTCCTGTGTGCCAGGCTGATGG + Intronic
1175667601 20:60873461-60873483 TCTACTGTTTACAAGGATCCTGG + Intergenic
1176122608 20:63460858-63460880 CCACCTGTGGACATGGATGACGG - Intronic
1177345444 21:19862401-19862423 GCTTCTGTGTACAATGATCAGGG + Intergenic
1177757422 21:25363926-25363948 TCTCCTGTGTATAAGGATAACGG + Intergenic
1179900316 21:44389532-44389554 CCAAGTGTGGACAAGGATGTAGG - Intronic
1181132738 22:20743027-20743049 ACTGCTGGGTACAATGATGAGGG - Intronic
1181885621 22:26019993-26020015 CCTACTGGGCAGAAGGCTGACGG - Intronic
1182116531 22:27759704-27759726 CCTACTGTGTGCTAGGAAGCAGG - Intronic
1184368202 22:44066120-44066142 CCTACTGTGTACCAGGTGGGTGG + Intronic
1185000792 22:48244452-48244474 GTTACTGTGGACCAGGATGACGG - Intergenic
950955002 3:17043290-17043312 CCTACTGTGTACCAGAGTCACGG - Intronic
951061797 3:18217237-18217259 CCTACTTTCTACAAGGGTAAAGG - Intronic
951578421 3:24137189-24137211 CCTACTGTGTACAAGGCATTGGG + Intronic
953691578 3:45124398-45124420 CCTTCTCTGTCCAAGGAAGATGG + Intronic
954876243 3:53804871-53804893 CCTACTGTGTCCAAGGGAGGAGG + Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
956722960 3:72134389-72134411 CCTACTGTGTGCTAGACTGAGGG + Intergenic
956847018 3:73193096-73193118 ACTACTGTGCTCAAGGAAGAGGG + Intergenic
962502407 3:136008913-136008935 ACTAATGTAAACAAGGATGAAGG - Intronic
963179030 3:142334493-142334515 TCTGCTGTTTACAAGGATTATGG - Intronic
965681986 3:171261089-171261111 CCTACTGTGTGGAAGGATTGAGG + Intronic
970309694 4:14769147-14769169 TCTGCTGTTTACAAGGATGAAGG + Intergenic
971570680 4:28206679-28206701 CCTACTGTGTACTAGGCCCATGG - Intergenic
974314471 4:60260452-60260474 CCTACTGAGTACAAGGTTTCAGG - Intergenic
978134465 4:105240549-105240571 CACACTGTGTAGAAGGATGGAGG + Intronic
982340986 4:154298426-154298448 TCAGCTGTGGACAAGGATGAAGG - Exonic
983467932 4:168118157-168118179 CCTTCTGTGTATAAGGATTGAGG + Intronic
989089121 5:37711035-37711057 TCTACTGTCTACAATGGTGATGG + Intronic
995037139 5:107547142-107547164 CCTACTGTACACATGGATCATGG + Intronic
995659231 5:114462431-114462453 GTTTCTGTGTTCAAGGATGAAGG + Intronic
999728430 5:154456536-154456558 CCTACTGTGTACAAGGCACAGGG - Exonic
1007095066 6:39207952-39207974 CCAACTGTGTTCAAGGATACAGG - Intronic
1014741822 6:125154870-125154892 CCTACTGTGTAAAAGAATGGTGG - Intronic
1015807980 6:137131710-137131732 GATACTGTGCCCAAGGATGATGG - Intergenic
1016673782 6:146739210-146739232 CCTAATCTATACAAGGATGTTGG - Intronic
1017453430 6:154575858-154575880 CCTGCTGTGTTAAAGGATCAGGG + Intergenic
1022618087 7:31953033-31953055 CCTACTGTGGAAAAGCATGCAGG - Intronic
1024045733 7:45584431-45584453 CCCACTGTGGACAAAGAGGATGG + Intronic
1024657287 7:51461771-51461793 TCTACTGTGGAGAAGGATGTGGG + Intergenic
1025066909 7:55864946-55864968 TATACTGTATACAAGTATGATGG + Intergenic
1026004290 7:66588858-66588880 CCTACCCTGTTCAAGGATCAAGG + Intergenic
1026017150 7:66680570-66680592 CCTAATGTGTGCTAGGCTGAGGG - Intronic
1026026946 7:66753134-66753156 CCTACCCTGTTCAAGGATCAAGG - Intronic
1028723985 7:94066261-94066283 CCTAGTGTGGTCAAGGATGGTGG + Intergenic
1030205437 7:106948233-106948255 ATAACTGTGTTCAAGGATGATGG - Intergenic
1037643786 8:20772013-20772035 CCTACTGTGTGCAGGTATCAGGG + Intergenic
1042295463 8:67212682-67212704 CCTGCTGTGTGAAAGGAAGATGG + Intronic
1042847880 8:73186469-73186491 CCTTGCGTGTACAAGGAGGAAGG + Intergenic
1042847992 8:73187376-73187398 CCTCGCGTGTACAAGGAGGAAGG - Intergenic
1046645480 8:116781434-116781456 CTTACTGTGCACCAGGATCATGG + Intronic
1048659975 8:136588366-136588388 CCTACTTTATACAAACATGAAGG + Intergenic
1048913095 8:139155293-139155315 CCTACTGTGAACAAGGACTGTGG + Intergenic
1048991813 8:139764973-139764995 CCTACTGTGCCCTGGGATGATGG - Intronic
1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG + Intergenic
1056014504 9:82369125-82369147 CCTACATTATACAATGATGAGGG + Intergenic
1058912001 9:109529465-109529487 CCTGCTGTGAAAAAGGATTAAGG - Intergenic
1060063520 9:120482629-120482651 CCACCTGTTTACAAGGCTGAGGG + Intronic
1060215305 9:121735404-121735426 CCTACTGTGTACAGGCAGGCAGG - Intronic
1061519862 9:131111715-131111737 GGTCCTGTGTGCAAGGATGAGGG - Intronic
1187221760 X:17334091-17334113 CCTTCTGTGTACTCAGATGATGG + Intergenic
1187528614 X:20076359-20076381 ACTACTGACTACTAGGATGAAGG + Intronic
1188472921 X:30560492-30560514 CCTACTGTGTACCAGGACTATGG + Intronic
1189859418 X:45257813-45257835 CCTGCTGAGTACATGGATGGAGG + Intergenic
1190733351 X:53239050-53239072 CCTACTTGGTCCCAGGATGAGGG - Intronic
1192141578 X:68651163-68651185 CCTCCTATGCACAAGCATGAGGG + Intronic
1196693901 X:118590692-118590714 CCTACTGTGTAAAACCATAAGGG - Intronic
1197137527 X:123080423-123080445 CTTATTTTGTACAAGTATGAAGG - Intergenic