ID: 1073207866

View in Genome Browser
Species Human (GRCh38)
Location 10:101778272-101778294
Sequence CAGAGCAGGGAGTAGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073207860_1073207866 12 Left 1073207860 10:101778237-101778259 CCCACCATGGACTCTCTGAACAT 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG No data
1073207862_1073207866 8 Left 1073207862 10:101778241-101778263 CCATGGACTCTCTGAACATCAGT 0: 1
1: 0
2: 1
3: 51
4: 298
Right 1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG No data
1073207861_1073207866 11 Left 1073207861 10:101778238-101778260 CCACCATGGACTCTCTGAACATC 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073207866 Original CRISPR CAGAGCAGGGAGTAGGCCCC AGG Intronic
No off target data available for this crispr