ID: 1073208246

View in Genome Browser
Species Human (GRCh38)
Location 10:101779952-101779974
Sequence CCGAGTCCCGCCACTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073208246_1073208266 29 Left 1073208246 10:101779952-101779974 CCCAGAGCAGTGGCGGGACTCGG No data
Right 1073208266 10:101780004-101780026 GCCTCTAGAGGCCAGGGAAGCGG No data
1073208246_1073208251 -6 Left 1073208246 10:101779952-101779974 CCCAGAGCAGTGGCGGGACTCGG No data
Right 1073208251 10:101779969-101779991 ACTCGGAGGCCCCGGCCCCACGG No data
1073208246_1073208259 17 Left 1073208246 10:101779952-101779974 CCCAGAGCAGTGGCGGGACTCGG No data
Right 1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG No data
1073208246_1073208262 22 Left 1073208246 10:101779952-101779974 CCCAGAGCAGTGGCGGGACTCGG No data
Right 1073208262 10:101779997-101780019 GCCCGGAGCCTCTAGAGGCCAGG No data
1073208246_1073208255 5 Left 1073208246 10:101779952-101779974 CCCAGAGCAGTGGCGGGACTCGG No data
Right 1073208255 10:101779980-101780002 CCGGCCCCACGGCGCCCGCCCGG No data
1073208246_1073208264 23 Left 1073208246 10:101779952-101779974 CCCAGAGCAGTGGCGGGACTCGG No data
Right 1073208264 10:101779998-101780020 CCCGGAGCCTCTAGAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073208246 Original CRISPR CCGAGTCCCGCCACTGCTCT GGG (reversed) Intronic