ID: 1073208252

View in Genome Browser
Species Human (GRCh38)
Location 10:101779978-101780000
Sequence GGGCGGGCGCCGTGGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073208252_1073208262 -4 Left 1073208252 10:101779978-101780000 CCCCGGCCCCACGGCGCCCGCCC No data
Right 1073208262 10:101779997-101780019 GCCCGGAGCCTCTAGAGGCCAGG No data
1073208252_1073208269 18 Left 1073208252 10:101779978-101780000 CCCCGGCCCCACGGCGCCCGCCC No data
Right 1073208269 10:101780019-101780041 GGAAGCGGTACGACCACGAGCGG No data
1073208252_1073208266 3 Left 1073208252 10:101779978-101780000 CCCCGGCCCCACGGCGCCCGCCC No data
Right 1073208266 10:101780004-101780026 GCCTCTAGAGGCCAGGGAAGCGG No data
1073208252_1073208264 -3 Left 1073208252 10:101779978-101780000 CCCCGGCCCCACGGCGCCCGCCC No data
Right 1073208264 10:101779998-101780020 CCCGGAGCCTCTAGAGGCCAGGG No data
1073208252_1073208259 -9 Left 1073208252 10:101779978-101780000 CCCCGGCCCCACGGCGCCCGCCC No data
Right 1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073208252 Original CRISPR GGGCGGGCGCCGTGGGGCCG GGG (reversed) Intronic