ID: 1073208259

View in Genome Browser
Species Human (GRCh38)
Location 10:101779992-101780014
Sequence CGCCCGCCCGGAGCCTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073208253_1073208259 -10 Left 1073208253 10:101779979-101780001 CCCGGCCCCACGGCGCCCGCCCG No data
Right 1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG No data
1073208245_1073208259 20 Left 1073208245 10:101779949-101779971 CCGCCCAGAGCAGTGGCGGGACT No data
Right 1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG No data
1073208248_1073208259 16 Left 1073208248 10:101779953-101779975 CCAGAGCAGTGGCGGGACTCGGA No data
Right 1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG No data
1073208252_1073208259 -9 Left 1073208252 10:101779978-101780000 CCCCGGCCCCACGGCGCCCGCCC No data
Right 1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG No data
1073208246_1073208259 17 Left 1073208246 10:101779952-101779974 CCCAGAGCAGTGGCGGGACTCGG No data
Right 1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073208259 Original CRISPR CGCCCGCCCGGAGCCTCTAG AGG Intronic