ID: 1073210130

View in Genome Browser
Species Human (GRCh38)
Location 10:101793686-101793708
Sequence CTAGAGCCGCTGCGCTTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073210128_1073210130 6 Left 1073210128 10:101793657-101793679 CCTGCAAAGAAACAATGTGAAGT 0: 1
1: 0
2: 0
3: 14
4: 226
Right 1073210130 10:101793686-101793708 CTAGAGCCGCTGCGCTTCGCAGG 0: 1
1: 0
2: 1
3: 1
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073210130 Original CRISPR CTAGAGCCGCTGCGCTTCGC AGG Intronic
901741672 1:11345868-11345890 CGTGAGCCACTGCGCTTGGCCGG + Intergenic
908757767 1:67484807-67484829 CTTGAGCCACTGCGCCTGGCTGG - Intergenic
911836281 1:102623046-102623068 CTAGAGCAGCTGTGCTGTGCTGG + Intergenic
915844781 1:159252151-159252173 GTAGAGCAGCTGCGCTATGCTGG - Intergenic
916343282 1:163759443-163759465 CTAGGGCTGCTGCGGTTTGCTGG - Intergenic
918407504 1:184225462-184225484 CTAGAGCAGCCGCCCTTCTCAGG - Intergenic
920435956 1:205947354-205947376 CTTGAGCCCCTGGGCTTCCCAGG - Intergenic
920579302 1:207089988-207090010 CTTGAGCCGCTGCGCCCGGCCGG - Intronic
922336664 1:224623814-224623836 CTTCAGCCACTGCCCTTCGCAGG + Intronic
922687148 1:227649629-227649651 CATGAGCCACTGCGCTTAGCCGG + Intronic
923277963 1:232415097-232415119 CGGGAGCTGCTGGGCTTCGCCGG - Intronic
1063417024 10:5881966-5881988 CTTGAGCCACTGCGCCTGGCCGG + Intronic
1064898160 10:20262583-20262605 GTAGAGCAGCTGTGCTTTGCTGG - Intronic
1073210130 10:101793686-101793708 CTAGAGCCGCTGCGCTTCGCAGG + Intronic
1076402107 10:130191022-130191044 CTCGAGCCGCAGGGCGTCGCAGG + Intergenic
1083751003 11:64760495-64760517 CTAGAGCTGCTCAGCTTCGGTGG - Intergenic
1084072327 11:66744610-66744632 CTAGAGCCTCTGAGCGCCGCGGG - Intronic
1085648995 11:78250331-78250353 CTAGAGCTGCTGAGCTCAGCTGG + Exonic
1099498269 12:83379006-83379028 ATAGAGCTGCTGTGCTTTGCTGG + Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1105830550 13:24160523-24160545 CAAGAGCCACTGCGCCTGGCCGG + Intronic
1108222221 13:48247105-48247127 CATGAGCCACTGCGCTTGGCCGG + Intronic
1109411998 13:61982515-61982537 CTTGAGCCACTGCGCCTGGCCGG - Intergenic
1110788514 13:79561131-79561153 CTAGAGCAGCTGTGCTGTGCTGG - Intergenic
1113260819 13:108560251-108560273 CTTGAGCAGCAGAGCTTCGCTGG + Intergenic
1119246733 14:73116154-73116176 CTAGAGCCCCGGCACTTCTCAGG - Intronic
1119325056 14:73754933-73754955 CTAAAGCCGCTCAGCTTCTCTGG - Intronic
1202836217 14_GL000009v2_random:79139-79161 CTAGAGCAGCTGTGCTATGCCGG - Intergenic
1124600068 15:31126680-31126702 CTTGAGCCACTGCGCCTGGCCGG - Intronic
1127118775 15:55753317-55753339 CGTGGGCCGCTGCGCTTGGCTGG - Intergenic
1127734458 15:61828441-61828463 CTAAAGCTGCAGTGCTTCGCAGG + Intergenic
1133220534 16:4317440-4317462 CCAGAGACACTGCGCTTCGGAGG + Intronic
1137519476 16:49179857-49179879 CCAGAGCAGCTGCCCTTCCCTGG + Intergenic
1138228853 16:55323696-55323718 CTGCAGCCCCTGCGCTCCGCTGG - Intergenic
1138414501 16:56863738-56863760 CGTGAGCCACTGCGCTTAGCTGG - Intergenic
1140856021 16:78978451-78978473 CTGGAACCCCTGCACTTCGCTGG - Intronic
1143255506 17:5554738-5554760 CTAGAGCCACTGCACTCAGCTGG - Intronic
1145028627 17:19487919-19487941 CGTGAGCCACTGCGCTTGGCCGG + Intergenic
1150797123 17:68247607-68247629 GTAGAGCCGCAGCGCTCCCCGGG - Exonic
1150819103 17:68420634-68420656 CGAGAGCAGCTGAGCTGCGCTGG + Exonic
1152015269 17:77746616-77746638 CAAGAGCTGCTGTGCTTTGCCGG + Intergenic
1152057978 17:78046457-78046479 CGAGAGCCACTGCGCCTGGCCGG + Intronic
1152390711 17:80002173-80002195 CTAGAGCCAGTGCGCTTGGTGGG - Intronic
1161077013 19:2290725-2290747 CTAGAGACGCTGCGCGTGGACGG - Exonic
1161663784 19:5562931-5562953 TGTGAGCCGCTGCGCCTCGCTGG + Intergenic
1163013736 19:14441167-14441189 CTAGAGCAGCTGGGCCTGGCCGG + Exonic
1164032710 19:21422574-21422596 CTTGAGCCACTGCACTTGGCTGG + Intronic
1164232490 19:23302570-23302592 GTAGAGCCACTGTGCTTTGCTGG + Intergenic
1202636421 1_KI270706v1_random:48223-48245 CTAGAGCAGCTGTGCTATGCCGG + Intergenic
931728105 2:65130265-65130287 CCAGAGGCGCGGCGCTTGGCGGG - Intergenic
932132075 2:69196984-69197006 CTAGAGCCACCGCCCTTCCCTGG + Intronic
935179814 2:100679425-100679447 CTAGGGCAGCTGGGCTCCGCTGG + Intergenic
946231654 2:218295160-218295182 CCAGAGCAGCAGTGCTTCGCTGG + Intronic
1171882552 20:30629149-30629171 CTAGAGCAGCTGTGCTATGCTGG + Intergenic
1172442495 20:34975995-34976017 CGTGAGCCACTGCGCTTGGCCGG + Intronic
1172528543 20:35615913-35615935 CTTCAGCCGCTGCGCGCCGCGGG - Exonic
1176288951 21:5034167-5034189 CAAGGGGCGCTGGGCTTCGCAGG + Intronic
1179868283 21:44229437-44229459 CAAGGGGCGCTGGGCTTCGCAGG - Intronic
1184119071 22:42438532-42438554 CCAGAGCCCCTGCCCTTCCCAGG - Intergenic
1184762986 22:46555740-46555762 CTCGAGCCACTGCGCCTGGCCGG - Intergenic
950566879 3:13774660-13774682 CGTGAGCCACTGCGCTTGGCCGG + Intergenic
950632155 3:14289244-14289266 CTAGAGCTGCTCCCCTTCACAGG - Intergenic
962259630 3:133894725-133894747 CTAGACCCGCTGCCCTTCGCCGG - Intronic
973366226 4:49211592-49211614 CTAGAGCAGCTGTGCTATGCCGG + Intergenic
973394375 4:49580843-49580865 CTAGAGCAGCTGTGCTATGCCGG - Intergenic
974038081 4:56834647-56834669 CTTGAGCCACTGCGCCTGGCCGG - Intergenic
979085186 4:116399654-116399676 CGTGAGCCGCTGCGCTTGGCTGG + Intergenic
984801856 4:183723164-183723186 CCCGCGCCGCTGCGGTTCGCAGG + Intergenic
1202763739 4_GL000008v2_random:134093-134115 CTAGAGCAGCTGTGCTATGCTGG + Intergenic
989092152 5:37744154-37744176 CTAGAGCTGCTGCAGTTTGCTGG - Intronic
994043672 5:95284877-95284899 CTGGAGCCGCGGAGCTTCGAGGG - Intergenic
995862532 5:116656822-116656844 CTAGAGCAGCTGAGCTTTCCAGG + Intergenic
999596996 5:153215434-153215456 GTAGAGCTGCTGCTCTTTGCTGG - Intergenic
1001728336 5:173927494-173927516 CTTGAGCCACTGCGCCTGGCTGG - Intronic
1005086758 6:22015026-22015048 CATGAGCCGCTGCGCCTGGCCGG + Intergenic
1017536216 6:155350042-155350064 ATAGAGCTGCTGCGCTGTGCTGG + Intergenic
1019087040 6:169488226-169488248 CTAGAGACGCTGCTCTAAGCTGG - Intronic
1019816769 7:3206739-3206761 CTAGAGCAGTTGTGCTTTGCAGG + Intergenic
1025277119 7:57592628-57592650 CGTGAGCCACTGCGCTTGGCTGG + Intergenic
1026289125 7:68990134-68990156 CTTGAGCCACTGCGCCTGGCTGG - Intergenic
1027180438 7:75935525-75935547 CTTGAGCCACTGCGCCTGGCTGG + Intronic
1036171305 8:6488265-6488287 TTGGAGCCGCTGTGCTTCCCAGG + Intronic
1038122454 8:24632782-24632804 CTTGAGCCACTGCGCCTGGCTGG - Intergenic
1054985244 9:71254197-71254219 CAAGAGCCACTGCGCCTGGCTGG + Intronic
1060667231 9:125439180-125439202 CCAGAGCCGCTGCTCTACGATGG + Intronic
1062497676 9:136839316-136839338 CTGGTGCTGCTGCGCTTCTCCGG - Exonic
1203544492 Un_KI270743v1:118966-118988 CTAGAGCAGCTGTGCTATGCCGG + Intergenic
1187169317 X:16835986-16836008 CATGAGCCACTGCGCCTCGCAGG - Intronic
1189772199 X:44437907-44437929 CGTGAGCCACTGCGCTCCGCAGG - Intergenic
1189861330 X:45275740-45275762 CTAGGGCTGCTGCGGTTTGCTGG + Intergenic
1197030058 X:121802713-121802735 CTGGAGGGGCTGTGCTTCGCTGG + Intergenic
1197489634 X:127101245-127101267 GTAGAGCCGCTGCTGTTTGCTGG - Intergenic
1198648705 X:138837723-138837745 GTAGAGCCGCTGCACTGTGCTGG + Intronic
1200159036 X:153995236-153995258 CGTGAGCCACTGCGCCTCGCTGG - Intergenic