ID: 1073215519

View in Genome Browser
Species Human (GRCh38)
Location 10:101834051-101834073
Sequence GAGTAGATATGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1009
Summary {0: 1, 1: 0, 2: 2, 3: 74, 4: 932}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073215519 Original CRISPR GAGTAGATATGGAGGGAGGA GGG (reversed) Intronic
900391540 1:2436060-2436082 GAGGAGAGAGGAAGGGAGGAGGG - Intronic
900391629 1:2436328-2436350 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391649 1:2436381-2436403 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391656 1:2436403-2436425 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391671 1:2436448-2436470 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391706 1:2436547-2436569 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900498762 1:2989441-2989463 GAGTATAGATGGATGGAGGATGG - Intergenic
900774467 1:4571876-4571898 GAGCAGATAGGAAGGGAGGGAGG + Intergenic
900863103 1:5246575-5246597 GAGGAGAGAGGGAGGGAGGGAGG - Intergenic
900993446 1:6108193-6108215 GTGGAGAGATGGAGGGATGATGG + Intronic
901078430 1:6570000-6570022 GAGGAGAGAGGGAGGGAGGGAGG + Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901352710 1:8611901-8611923 GAGTAGTGAGGGAGGTAGGAAGG - Intronic
901517104 1:9755368-9755390 GGGTGGAGATGGGGGGAGGAGGG - Intronic
901661204 1:10798997-10799019 GAGAAGGAATGGAGAGAGGATGG - Intergenic
902613694 1:17612084-17612106 GAGAATGAATGGAGGGAGGATGG - Intronic
902833114 1:19030211-19030233 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
903333574 1:22610050-22610072 AAGAAGAGAGGGAGGGAGGAAGG - Intergenic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
904683706 1:32246319-32246341 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
904847963 1:33435039-33435061 GTGTATATATGGATGGGGGAAGG - Intergenic
904928786 1:34069756-34069778 GATTAGATTTGGAGAAAGGAGGG + Intronic
905370200 1:37478995-37479017 GAGAAGCTAGGGAGGGAGGTGGG - Intronic
905445881 1:38028360-38028382 GAGCAGATGAGGAGAGAGGATGG - Intergenic
905462306 1:38129759-38129781 GAGAAGATAGGAAGGCAGGACGG - Intergenic
905481931 1:38267810-38267832 AAGAAGGGATGGAGGGAGGAAGG - Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
905930570 1:41784027-41784049 GAGTAGGTAGGGAAGAAGGATGG + Intronic
906329295 1:44871331-44871353 GGGTAAACATGGAGGCAGGAAGG - Intronic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906747639 1:48232822-48232844 GAGAAAAGAGGGAGGGAGGAAGG + Intronic
907019722 1:51055142-51055164 GGGGAGAGAGGGAGGGAGGAAGG - Intergenic
907076345 1:51582655-51582677 GTGTAGAGAAGGAGGGAGGCAGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907399743 1:54217545-54217567 AAGTAGAAATGAAGGCAGGAAGG - Intronic
907486892 1:54784277-54784299 GAGAAGAGATGGGAGGAGGAGGG - Intronic
907752264 1:57273635-57273657 GAGAAGACAGGGAGGGAGGGAGG - Intronic
907794969 1:57707148-57707170 GAGTAGAGTTGGGGGTAGGAGGG - Intronic
907858487 1:58327282-58327304 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
908852261 1:68387528-68387550 AAGGAGAAATGGAGGGTGGAAGG - Intergenic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909942363 1:81625297-81625319 GAGGAGAGAGGGAGGGAGGGAGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910532217 1:88250469-88250491 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
910713079 1:90202019-90202041 GAGGAGGGAGGGAGGGAGGAAGG + Intergenic
911316382 1:96361423-96361445 GAGTAGAAGAGGAGGGAGAAAGG - Intergenic
911474523 1:98359277-98359299 GATAAGATATGGAGGGTAGAAGG - Intergenic
911477704 1:98393830-98393852 GTGTAGAAAGGGAGGGAAGAAGG + Intergenic
911641173 1:100290904-100290926 GAGAAGGTATGTGGGGAGGAGGG - Intronic
911656091 1:100445520-100445542 AAGGAGAGATGGAGGCAGGAGGG + Intronic
911759935 1:101602520-101602542 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
912173278 1:107126701-107126723 TTGTAGATATGGGTGGAGGAAGG - Intergenic
912537967 1:110389892-110389914 TACAAGATAGGGAGGGAGGAGGG + Intronic
913163891 1:116168186-116168208 GAGAAGCTAAGGAGGGAGGATGG + Intergenic
914385202 1:147162473-147162495 AAGTAGATGAGGAGGAAGGATGG + Exonic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
914829830 1:151162874-151162896 GAGTAGAAATAGAGCGAGGAAGG - Intronic
915288517 1:154867944-154867966 GAGTGGAGATGGAGGAAGGTGGG - Intronic
915309097 1:154998392-154998414 GAGTAGGAATGGAGACAGGAGGG + Intergenic
915460348 1:156066833-156066855 GAGAAGCTAAGGTGGGAGGATGG + Intronic
915823444 1:159050644-159050666 GAGGAGGTATGGAGGCAAGAAGG - Intronic
915841085 1:159213568-159213590 GGGAAGAAGTGGAGGGAGGAAGG + Intergenic
916400265 1:164440038-164440060 GAGGAGGGAGGGAGGGAGGAAGG + Intergenic
916417213 1:164603068-164603090 GAGTGGGTATGGAAGAAGGAAGG - Intronic
916522794 1:165580277-165580299 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
916667696 1:166981487-166981509 GTGTAGAGAGGGAGGGAGGGAGG + Intronic
916738709 1:167630196-167630218 GAGGAGGGAGGGAGGGAGGAAGG - Exonic
917045587 1:170856330-170856352 GAGAAGAGAAGAAGGGAGGAGGG + Intergenic
917439511 1:175054761-175054783 GAGTAGAGCTGGAGGGAGATGGG + Intergenic
917465342 1:175271149-175271171 GATTAGACAGGTAGGGAGGAGGG - Intergenic
917604032 1:176607344-176607366 AAGTAGATATGAAGAGAGGTAGG - Intronic
919347996 1:196411030-196411052 GAGGAGGGAGGGAGGGAGGAAGG - Intronic
919780850 1:201220021-201220043 AAGAAGACAGGGAGGGAGGAAGG - Intronic
919780860 1:201220107-201220129 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
919780869 1:201220146-201220168 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
920507995 1:206530664-206530686 GAGTAGAAAAGCAGGGAGGAGGG + Intronic
920747918 1:208646446-208646468 GAGGAATAATGGAGGGAGGAAGG - Intergenic
920967855 1:210716071-210716093 GAGTAGAAATGGCGGGGGGAGGG - Intronic
921294999 1:213693218-213693240 GAGGAGAGAAGGAGGGAAGAGGG - Intergenic
922049684 1:221977552-221977574 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922063658 1:222115458-222115480 CATTAGAAAAGGAGGGAGGAAGG - Intergenic
922154218 1:223028853-223028875 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
922352914 1:224749250-224749272 GATTTGATATGGAGAGAGAATGG - Intergenic
922531715 1:226350070-226350092 GAGGAGAGAAGGAGGCAGGATGG - Intergenic
922599530 1:226838972-226838994 GACTGGATATGGAGGGTGGGAGG + Intergenic
922845609 1:228681784-228681806 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
922934678 1:229413659-229413681 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
923082143 1:230668239-230668261 GAAAAGATAAGGAGGGAGAAGGG + Intronic
923300475 1:232635562-232635584 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
923563404 1:235058936-235058958 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
923853052 1:237817953-237817975 GAGTAGAAATGGAGTAAGAATGG + Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1062979371 10:1708996-1709018 TTTTAAATATGGAGGGAGGAGGG + Intronic
1063368075 10:5503468-5503490 GAGAAGATATGCAGGGTGTAGGG + Intergenic
1063525282 10:6778981-6779003 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1064321492 10:14309670-14309692 TGTTAGATATGGAGGCAGGAGGG - Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064823131 10:19362384-19362406 GATTAGATTTGGAGGGAGTGAGG - Intronic
1064963250 10:20989561-20989583 GAGAAGACAGGGAGGGAGGAGGG + Intronic
1065485309 10:26231205-26231227 TAGGAGACAGGGAGGGAGGAAGG + Intronic
1065765624 10:29026893-29026915 AGGTAGAAAGGGAGGGAGGAAGG + Intergenic
1066192542 10:33069226-33069248 CAGAAGAGATGGAGGAAGGAAGG - Intergenic
1066290500 10:34010087-34010109 AAGGAGAGATGGAGGGAGGGAGG + Intergenic
1066299769 10:34086583-34086605 GAGTAAGAAAGGAGGGAGGAAGG + Intergenic
1066440199 10:35431334-35431356 GGGAAGATGTGGGGGGAGGAGGG - Intronic
1066594443 10:37034562-37034584 GATTTGATGTAGAGGGAGGATGG + Intergenic
1067270953 10:44790895-44790917 GTTTAGATAAGGAGGGAGAAAGG - Intergenic
1067476181 10:46568097-46568119 GAGAAGAGAGGGAGGGAGGGGGG - Intergenic
1067618557 10:47773683-47773705 GAGAAGAGAGGGAGGGAGGGGGG + Intergenic
1067853473 10:49769858-49769880 GGGGAGAGAGGGAGGGAGGAAGG + Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1067993527 10:51242942-51242964 AATTAGATTTGGAGGGAGGCTGG + Intronic
1068227693 10:54127571-54127593 GTCTAGAAATGGAGTGAGGAAGG + Intronic
1068292646 10:55024145-55024167 GAATATATATAGAGAGAGGAAGG + Intronic
1068292648 10:55024167-55024189 GAATATATATAGAGAGAGGAAGG + Intronic
1069558315 10:69412403-69412425 GAGCAGATAAGAGGGGAGGAGGG + Intronic
1069639257 10:69944263-69944285 GAGAAGAGATGGAAGAAGGAAGG - Intronic
1069717218 10:70529080-70529102 GAGTGGATATTGAGGGACAATGG + Intronic
1070088260 10:73257625-73257647 GTGTAGATTTGGAGGAAGTAAGG - Intronic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071307777 10:84314317-84314339 GAATAGATCTGAATGGAGGAAGG + Intergenic
1071444889 10:85736261-85736283 AAGGAGAGAAGGAGGGAGGAGGG + Intronic
1071569637 10:86689915-86689937 GAGAATATATGCAGGGAAGATGG - Intronic
1071904754 10:90160581-90160603 GAATAGATATGGAGAGAATAGGG - Intergenic
1073072710 10:100805101-100805123 GAATAGATATGGAGGGAAGATGG + Intronic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073521194 10:104131050-104131072 GAGGAGGCAGGGAGGGAGGAAGG + Intronic
1073529335 10:104216914-104216936 GAGTAGCTATGAAAGGAGGAAGG - Intronic
1073566055 10:104536601-104536623 GAGGAGAGAGGGAGGGAGGGAGG + Intergenic
1073618184 10:105019475-105019497 GAGAAGAGATGGAAAGAGGAAGG - Intronic
1073652432 10:105375848-105375870 GAGTAGAAGTGGAGGTTGGAAGG - Intergenic
1073662624 10:105493619-105493641 GAGTAGATGGAAAGGGAGGATGG + Intergenic
1075105588 10:119538167-119538189 GAGGAGAGAGGGATGGAGGAAGG + Intronic
1075235899 10:120728356-120728378 GAGAAGATATGGACACAGGAAGG - Intergenic
1076676738 10:132151013-132151035 GAGAAGGAATGGATGGAGGATGG - Intronic
1076717458 10:132373681-132373703 GAGTAGATGCTGAGAGAGGAAGG + Intronic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1077671371 11:4160859-4160881 AAGTAGATCTGGAGGGACAAAGG - Intergenic
1077722819 11:4644855-4644877 GAGAAGATGAGGCGGGAGGAAGG - Intronic
1077750806 11:4966452-4966474 GATTAGATATGGAGGGTGAATGG + Intronic
1077761342 11:5102998-5103020 GAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1078159906 11:8831449-8831471 GAGAAGATCTGGAGAGACGATGG - Intronic
1078451676 11:11445072-11445094 GATCAGTTTTGGAGGGAGGAAGG - Intronic
1078526260 11:12103886-12103908 GAGCAGTTAGGAAGGGAGGAAGG - Intronic
1078570589 11:12454169-12454191 GAGCAGATATGAAGGGAAGAAGG + Intronic
1078865260 11:15291348-15291370 GAGTGAATTTGGAGGGAGGTTGG - Intergenic
1078941698 11:16013634-16013656 GAGTAAAGAGGGAGGGAGGGAGG - Intronic
1079367102 11:19819026-19819048 AAGTAAAAATGGATGGAGGAAGG - Intronic
1080060210 11:27948971-27948993 GAGAAAGGATGGAGGGAGGATGG - Intergenic
1080888956 11:36391953-36391975 GGGTAGTTGTGGTGGGAGGAAGG - Intronic
1081538518 11:44013459-44013481 TAGTAGAGATGGGGGGTGGAGGG + Intergenic
1082757807 11:57095423-57095445 GTATTGATGTGGAGGGAGGAGGG + Intergenic
1083996145 11:66273682-66273704 GTGTAGACATGGACAGAGGAGGG - Intronic
1084256588 11:67947035-67947057 GTGCAGATCTGGAGGGTGGAAGG - Intergenic
1084470498 11:69356480-69356502 GAGGAAAGAAGGAGGGAGGAAGG + Intronic
1084936950 11:72592019-72592041 GAGTGGATCTAGAGGGGGGAAGG - Intronic
1085032783 11:73282766-73282788 GAGGAGGGAGGGAGGGAGGAAGG + Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085620279 11:78032655-78032677 GAGAAGATGTGGAGGAAAGAGGG - Intronic
1086026636 11:82301253-82301275 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1086079579 11:82889412-82889434 GAGGAGGGATGGAGGAAGGAGGG + Intronic
1086480745 11:87235264-87235286 GAAGAGAGATGGAGAGAGGAAGG + Intronic
1086862067 11:91936116-91936138 GAGCAGCGAGGGAGGGAGGAAGG + Intergenic
1086880563 11:92148612-92148634 GAGAAGATATGGAGGGAGAAAGG + Intergenic
1087805271 11:102548538-102548560 GAGGAGAAATGGAGGGAGCAAGG + Intergenic
1088152875 11:106768225-106768247 GAGAAGCTGAGGAGGGAGGATGG - Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088584132 11:111345525-111345547 GAGTGGATATGCAGAGAGAAGGG - Intergenic
1088941155 11:114457741-114457763 GACTAAATATGGAGGTAAGAAGG - Intergenic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089085628 11:115814822-115814844 GAGACCATGTGGAGGGAGGAGGG - Intergenic
1089180183 11:116578238-116578260 AAGAAGAAATGGAGGGAGGGAGG - Intergenic
1089633374 11:119797040-119797062 GATTAGAAAAGGAGGGAGAAAGG - Intergenic
1089687617 11:120166755-120166777 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1090107743 11:123870058-123870080 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1090719488 11:129458812-129458834 GAGTGGAAAAGGAGGCAGGAAGG - Intergenic
1091024990 11:132134160-132134182 GAGAAGCTAAGGTGGGAGGATGG - Intronic
1091658220 12:2361482-2361504 AAGGAGAAATGAAGGGAGGAAGG - Intronic
1091941881 12:4492989-4493011 GAGGAAAAATGGAGGGAGGTGGG - Intronic
1092552253 12:9515435-9515457 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1092836372 12:12492910-12492932 AAGTAAATATTGAGGAAGGAAGG - Intronic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1093232628 12:16566247-16566269 GAGCAGAGAGGGAAGGAGGAAGG + Intronic
1094125161 12:27015444-27015466 GATTAGATATGGAGGAAAGGGGG + Intergenic
1094339364 12:29393379-29393401 GAGGAGGTATGCAGGGAGAAGGG + Intergenic
1094519866 12:31175176-31175198 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1094667702 12:32537748-32537770 GAGTAGACATGAAGGGAATAAGG - Intronic
1095095898 12:38149070-38149092 GAGTAGTGAGGGAGGGAGGGAGG - Intergenic
1095253947 12:40011640-40011662 GAGGAGACGGGGAGGGAGGAAGG - Intronic
1095301932 12:40594648-40594670 GAGTAGAAGAGTAGGGAGGAGGG - Intergenic
1095323897 12:40863939-40863961 GAGAAGAGAGGGAGGGAGGGAGG - Intronic
1095461366 12:42447654-42447676 GAATAGAAATGGAAAGAGGAAGG - Intronic
1095587018 12:43860712-43860734 GAGGAGAAGTGGAGGGAGGTGGG + Intronic
1095736435 12:45561653-45561675 GAGGAGGGAGGGAGGGAGGAAGG - Intergenic
1095824284 12:46515769-46515791 GACTAGCCATGGAGGGAGGATGG + Intergenic
1095866679 12:46979740-46979762 GAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096561354 12:52438059-52438081 GAGTTTATATGGAAAGAGGAGGG + Intergenic
1098096363 12:66960890-66960912 GAGTAGCCAGGGAAGGAGGAGGG - Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098453733 12:70649439-70649461 GAGTAGAAAAGGATAGAGGAAGG + Intronic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100011657 12:89961229-89961251 GAGGATAGATGGAGGGAGAAAGG - Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100312393 12:93408601-93408623 AATTAGATATGGAGAGAGGTGGG + Exonic
1100472139 12:94903015-94903037 GAATAGATATGAGGTGAGGAAGG - Intronic
1101002286 12:100368571-100368593 TACTAGATTTGGAGGGAGTAGGG - Intronic
1101638317 12:106565928-106565950 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1101718687 12:107332722-107332744 GAGTACACATGAGGGGAGGAGGG + Intronic
1101858609 12:108464492-108464514 GAGAAGAAAGGCAGGGAGGATGG + Intergenic
1102015098 12:109643012-109643034 GAGCAAAGATGGAGGTAGGAAGG - Intergenic
1102552550 12:113702233-113702255 GGGGAGAGAAGGAGGGAGGAAGG - Intergenic
1102604274 12:114056719-114056741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103022139 12:117542581-117542603 GGTTAAATATGGGGGGAGGATGG - Intronic
1103030204 12:117606611-117606633 GGGAAGAAAGGGAGGGAGGAAGG - Intronic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1103444351 12:120984480-120984502 GAGAAGGGAAGGAGGGAGGAAGG + Intronic
1103540350 12:121661886-121661908 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1103949067 12:124541678-124541700 GAGTAGAGATGGAGGGGGTGGGG + Intronic
1104191072 12:126482426-126482448 GAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1104235970 12:126936917-126936939 GAGGAGAGCTGGAGAGAGGATGG + Intergenic
1105200953 13:18176686-18176708 GAGTAGGAATGGAGTGAGTAGGG - Intergenic
1105446519 13:20462036-20462058 GAGAAGAGAGGGTGGGAGGACGG + Intronic
1106309069 13:28537192-28537214 GAGGAGGTATGTAGGGAGAAGGG + Intergenic
1106719327 13:32422503-32422525 AAGTAGAAATGGATGAAGGAAGG - Intronic
1106899968 13:34345310-34345332 GGGCAGATGTGGAGGGAGGTGGG - Intergenic
1107771939 13:43796474-43796496 GAGTTGAGCTGGAAGGAGGAAGG - Intergenic
1107798813 13:44083839-44083861 GGGAAGATTAGGAGGGAGGAGGG + Intergenic
1107919991 13:45196461-45196483 GAATAGATTTTGAGGGAGAAGGG + Intronic
1108760827 13:53562243-53562265 GAGGAGAGATGGGGAGAGGAAGG - Intergenic
1108907138 13:55490553-55490575 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1110167569 13:72461492-72461514 GAGTAGATAACCAGGGAGAAGGG + Intergenic
1110658524 13:78029907-78029929 GAGTAAATCTGAAGGGAGCAGGG - Intergenic
1110772279 13:79363379-79363401 GAGAACACATGGTGGGAGGAGGG + Intronic
1111630307 13:90840721-90840743 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1111779427 13:92702834-92702856 GGGAAGTCATGGAGGGAGGAGGG - Intronic
1111894864 13:94128884-94128906 AAGTAGTTATGGAGGAAGAATGG - Intronic
1112890964 13:104230967-104230989 GAGGAGAGAGGGAGGGAGGTGGG - Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113037764 13:106070087-106070109 GAGGAGATGTGGGGGCAGGAGGG - Intergenic
1113087959 13:106587187-106587209 GATCAGATATAGAGGGTGGAGGG - Intergenic
1113207283 13:107931532-107931554 GAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1113614507 13:111671081-111671103 GAAGAGAGAGGGAGGGAGGAAGG - Intronic
1113619975 13:111755995-111756017 GAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1114387109 14:22266903-22266925 GAGCAGGTAGGGTGGGAGGAGGG + Intergenic
1114519298 14:23322744-23322766 GATTTGATTTGGAGGCAGGAGGG + Intronic
1114853113 14:26404391-26404413 GAGGAGGAATGGAGGAAGGATGG + Intergenic
1115629376 14:35228449-35228471 GCGGGGAGATGGAGGGAGGAAGG - Intronic
1116198569 14:41760679-41760701 GATGAGAGAGGGAGGGAGGAAGG + Intronic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1116340750 14:43720907-43720929 GAGAAGGTAGGGAGGAAGGAAGG - Intergenic
1116993647 14:51301209-51301231 GAATGGATATGGAGGGGTGAAGG - Intergenic
1117033785 14:51705463-51705485 GCCTAGACATGGAGGAAGGACGG - Intronic
1117079576 14:52137346-52137368 GAGGAGGTATGCAGGGAGAAGGG + Intergenic
1117162398 14:53002227-53002249 GAGATGAGAAGGAGGGAGGAGGG - Intergenic
1117232712 14:53737550-53737572 GAGGAGAAAGGGAGGAAGGAAGG + Intergenic
1118235119 14:63996191-63996213 GAGTGGAAAGGAAGGGAGGAAGG - Intronic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118708825 14:68503184-68503206 GAATGGATTTGGAGGGAGGGTGG + Intronic
1119022277 14:71125555-71125577 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1119348464 14:73944933-73944955 GAGGAGGTCTGGAGGGAGCAGGG - Intronic
1119939684 14:78627086-78627108 GAGAAGGGAGGGAGGGAGGAAGG - Intronic
1120205320 14:81581327-81581349 GAGAAGACAAGGAGAGAGGATGG + Intergenic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120886802 14:89458117-89458139 CAGGAGATTTGGAGGAAGGAAGG + Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121077020 14:91077352-91077374 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1121623004 14:95363164-95363186 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1121874133 14:97435328-97435350 GAGGAGAGACGCAGGGAGGAAGG - Intergenic
1122078048 14:99248152-99248174 GAGCAGGGAGGGAGGGAGGAGGG - Intronic
1122631427 14:103109323-103109345 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631441 14:103109359-103109381 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631455 14:103109395-103109417 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631469 14:103109431-103109453 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631483 14:103109467-103109489 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631497 14:103109503-103109525 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631525 14:103109576-103109598 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631539 14:103109612-103109634 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631553 14:103109648-103109670 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1123634748 15:22293032-22293054 GAGTAGTGAGGGAGGTAGGAAGG + Intergenic
1124129307 15:26970913-26970935 GGGTAGAAATGGCTGGAGGAAGG + Intergenic
1124211995 15:27771071-27771093 GAGAAAAGAGGGAGGGAGGAAGG - Intronic
1124702340 15:31927086-31927108 GGGTAGATAAGGAGATAGGATGG - Intergenic
1124710781 15:32008332-32008354 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
1124717888 15:32083570-32083592 GATGAGATAAGGAGGGTGGATGG + Intronic
1125164530 15:36686868-36686890 GAGGAAAGATGGAGGGAGGGTGG + Intronic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125608509 15:40955869-40955891 GAGCAGATATGGTGGGTGGCTGG + Exonic
1125749199 15:42017234-42017256 GAGTAGATATTGAAGGAGGCAGG - Intronic
1126321661 15:47430682-47430704 GAGTAGAAATGGGGGCAGGGTGG - Intronic
1127903581 15:63359293-63359315 GGGGAGCTTTGGAGGGAGGAAGG - Intronic
1128365027 15:66993404-66993426 GGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1128607912 15:69051061-69051083 AAGGAGAGATGCAGGGAGGAGGG - Intronic
1128643003 15:69353692-69353714 GGGTAGAAATGGAGGGAGGTGGG + Intronic
1129224179 15:74157029-74157051 AAGTAAATATGGAGAGAGCAAGG - Intergenic
1129676080 15:77632931-77632953 GAGGAGGGATCGAGGGAGGAGGG + Intronic
1130016728 15:80193208-80193230 GAATAGATCTGGAGGGACAAAGG - Intergenic
1130113487 15:80986270-80986292 GGGGAGATAGGGAGAGAGGATGG + Intronic
1130114616 15:80996016-80996038 GAGAAAGCATGGAGGGAGGAAGG + Intergenic
1130657917 15:85805184-85805206 GAGTAGATCTAGAGAGAGAAGGG + Intergenic
1130783465 15:87069905-87069927 GAGTAGATGTGGTGGGAGTTGGG - Intergenic
1130805422 15:87316009-87316031 GAAAAGATGTGGAGGAAGGAAGG + Intergenic
1130866777 15:87940149-87940171 GAATAGATGTTGAGGGAGGGGGG - Intronic
1131336146 15:91551306-91551328 GAGTAGATCTAGAGGGACAAAGG - Intergenic
1131787224 15:95926164-95926186 GAGTAGAAATGGGAGGAGGAAGG - Intergenic
1131915697 15:97263532-97263554 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1132713102 16:1277989-1278011 GAGGAGAGATGTAGGGAGGAGGG + Intergenic
1132942956 16:2517357-2517379 GAGTGACTATAGAGGGAGGAAGG - Intronic
1133459179 16:5972217-5972239 GAACAGATAGGGAGGGAGGGAGG - Intergenic
1133643356 16:7739281-7739303 GAGCAGAGAGGGAGGGAGGGGGG + Intergenic
1133671417 16:8024939-8024961 GAATATATATGGAGTGAGTATGG - Intergenic
1133689547 16:8199989-8200011 GAGAAGAGAGGGAGGGAGGAAGG - Intergenic
1133758649 16:8781035-8781057 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1133869752 16:9675938-9675960 AAGGAGAAATGGAGGGTGGAAGG + Intronic
1134212441 16:12289075-12289097 GAAGAGATAAGGAGGGAGGATGG + Intronic
1134310173 16:13068529-13068551 GAGTTTAGATGGAGAGAGGATGG + Intronic
1134881925 16:17752491-17752513 GAGGAGATGTGGGTGGAGGAAGG + Intergenic
1135514241 16:23116576-23116598 GAGAAGATAAGGAGGAAGAATGG - Intronic
1135591453 16:23707906-23707928 GAGTAGAGAAGGGTGGAGGATGG - Intronic
1136285576 16:29238493-29238515 AAGAAGAGATGGAGGGAGGGAGG + Intergenic
1136542324 16:30935013-30935035 GAGTAGAGAACGAGGCAGGAGGG + Intronic
1136938473 16:34498944-34498966 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
1136961346 16:34849613-34849635 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1137218721 16:46426805-46426827 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
1137641216 16:50031857-50031879 GTGTTGCCATGGAGGGAGGAAGG + Intronic
1137758773 16:50923844-50923866 AAGGAGGGATGGAGGGAGGAAGG + Intergenic
1137791629 16:51179919-51179941 TAGAAGAGAAGGAGGGAGGAGGG - Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138005080 16:53326817-53326839 GGGTAGAATTAGAGGGAGGAAGG - Exonic
1138600538 16:58051522-58051544 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
1139021467 16:62754972-62754994 GAGTTCATATGAAGGGAAGAGGG + Intergenic
1139296638 16:65907164-65907186 GAGTAGAAAGGGAGGTAGGGTGG + Intergenic
1140466727 16:75188988-75189010 GAGAAGAAAGGGAGAGAGGAGGG - Intergenic
1140833983 16:78776574-78776596 GAACAGATTTGGAGTGAGGATGG + Intronic
1141150968 16:81564499-81564521 GAGTTGATGTGGGGGGAAGAAGG + Intronic
1141672236 16:85498121-85498143 GAGTGGAGCTGGCGGGAGGAGGG + Intergenic
1142090909 16:88208645-88208667 AAGAAGAGATGGAGGGAGGGAGG + Intergenic
1142251420 16:88993706-88993728 GAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1142267401 16:89070882-89070904 GAGTAGCTGTGGAGGGTTGAGGG - Intergenic
1142355507 16:89599753-89599775 GAGAAGAGAGGGTGGGAGGAGGG - Intergenic
1142953893 17:3506985-3507007 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1143224522 17:5289147-5289169 AAGAAGAAAGGGAGGGAGGAAGG - Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143894497 17:10125646-10125668 GGGGAGATGAGGAGGGAGGAGGG + Intronic
1143963481 17:10739187-10739209 GAGGAGAGAGGAAGGGAGGAAGG - Intergenic
1144166491 17:12616447-12616469 GAGGAGATATGGTGGCGGGAGGG - Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144337568 17:14285424-14285446 GACTGGATATGGAAGGTGGAGGG + Intergenic
1144352899 17:14415809-14415831 AGGGAGAGATGGAGGGAGGAAGG - Intergenic
1144365677 17:14542018-14542040 GGGTAGAGAGGGAGAGAGGAGGG - Intergenic
1144380177 17:14687182-14687204 GAATAGATAAGGAGGGAGGGAGG + Intergenic
1144527386 17:16001318-16001340 AAATAGATGTGAAGGGAGGATGG - Intronic
1144665458 17:17099025-17099047 GAGGGGCTTTGGAGGGAGGAGGG + Intronic
1144728573 17:17513992-17514014 GAGGATAGATGGATGGAGGAAGG - Intronic
1144955779 17:19018139-19018161 GGGAAGAAAGGGAGGGAGGAAGG + Intronic
1145905266 17:28512784-28512806 GAGTAGCCAGGGAGGCAGGAGGG + Intronic
1145961794 17:28890983-28891005 GAGAAGCTAAGGTGGGAGGATGG - Intronic
1146422233 17:32698337-32698359 GGGAAGAGAGGGAGGGAGGAAGG - Intronic
1146488437 17:33262424-33262446 GAGGAGGAAGGGAGGGAGGAAGG + Intronic
1146963075 17:37001334-37001356 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1147122553 17:38344095-38344117 GAGCAGATGTGGATGGGGGATGG - Intergenic
1147310862 17:39595513-39595535 GAGGAGGGATGAAGGGAGGAGGG + Intergenic
1147445728 17:40474290-40474312 GAGAAGAGAGGGAGGGAGGGTGG + Intergenic
1147575130 17:41594597-41594619 GAGGACAGAGGGAGGGAGGAGGG + Intergenic
1148180689 17:45602452-45602474 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148180704 17:45602548-45602570 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148268199 17:46243378-46243400 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1148268214 17:46243472-46243494 GAAAAGAAAAGGAGGGAGGAAGG + Intergenic
1148621597 17:49038618-49038640 GGGCAGATAGGGAGGGAGAATGG + Intronic
1149090457 17:52772119-52772141 GAGAGTAGATGGAGGGAGGAAGG + Intergenic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150032668 17:61755717-61755739 GAGAAGAAAGGAAGGGAGGAAGG - Intronic
1150269047 17:63850538-63850560 GAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1150502031 17:65660282-65660304 GAAAAGAGAAGGAGGGAGGAAGG - Intronic
1150977812 17:70108788-70108810 AAGGAGAAAGGGAGGGAGGAAGG - Intronic
1151009684 17:70480289-70480311 CAGTTGATTTGGAGTGAGGAAGG + Intergenic
1151050916 17:70978240-70978262 AAGGAGAGATGGAGGGAAGAAGG + Intergenic
1151245919 17:72794567-72794589 GTGTAGAGAAGGAGGGAGCAGGG - Intronic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1151381263 17:73727291-73727313 GAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1152301733 17:79498839-79498861 GGGTAGATGTGGTGGGTGGAAGG - Intronic
1152367491 17:79865022-79865044 CAGTAGCTATAGAGGGTGGAGGG - Intergenic
1152574322 17:81133483-81133505 GAGAAGTCAGGGAGGGAGGAGGG - Intronic
1152652857 17:81503914-81503936 GAGAAGAAAGGGAGGGAGAAAGG + Intergenic
1152750587 17:82060761-82060783 GAGGAGATATCCAGGCAGGAGGG - Exonic
1152913043 17:83016490-83016512 GAGAAGGGATGGAGGGAGGAGGG + Intronic
1153417941 18:4870401-4870423 GAGTAGATTGGCAGGAAGGATGG - Intergenic
1153574120 18:6503974-6503996 GAGGAGGAAGGGAGGGAGGAGGG + Intergenic
1155041282 18:22067321-22067343 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1155228574 18:23751966-23751988 GAGCAGATCTGGAGGGTGAATGG + Intronic
1155466482 18:26141574-26141596 GATAGGATAGGGAGGGAGGATGG + Intronic
1155620147 18:27768971-27768993 GAGGAGAGAGGGAGGGAGGGAGG - Intergenic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1156252079 18:35360774-35360796 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1156579105 18:38354828-38354850 GAGTAGTTGTTGAGGGAGAAGGG + Intergenic
1158103797 18:53861413-53861435 GAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1158758533 18:60355939-60355961 GGAAAGAAATGGAGGGAGGAAGG - Intergenic
1158851057 18:61496090-61496112 GAGGAGAGAAGGAGAGAGGAAGG - Intronic
1158978749 18:62737895-62737917 GATTATATGTGGAGGGGGGAAGG + Intronic
1158985619 18:62813417-62813439 GAAGAGAGATGGAGGAAGGAAGG + Intronic
1159310262 18:66698469-66698491 GAGGAGAAAGGGAGGGAAGAAGG + Intergenic
1160135290 18:76266316-76266338 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160135310 18:76266387-76266409 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1160356147 18:78229695-78229717 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1160555882 18:79724875-79724897 AAGCAGCCATGGAGGGAGGACGG - Intronic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1160758624 19:771638-771660 GGGGAGATAGGGAGGGAGGAGGG - Intergenic
1160783023 19:886207-886229 GAGAAGGGAGGGAGGGAGGAGGG + Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161277615 19:3427500-3427522 GAGGATATATGGGGAGAGGAAGG + Intronic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1161853916 19:6753122-6753144 GAGTCGTTTTGGAGGGAGCAGGG + Intronic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1164286269 19:23820379-23820401 GAGAACATATTGAAGGAGGATGG - Intronic
1164581726 19:29439049-29439071 GGGGAGAGATGGAGGGAGGCAGG + Intergenic
1164772034 19:30816611-30816633 AAGAAGAAATGGAGGGAGGTAGG - Intergenic
1164975608 19:32570883-32570905 GAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1165386125 19:35511649-35511671 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166201474 19:41240232-41240254 GTGGATATATGGAGGGTGGATGG + Intronic
1166281278 19:41795854-41795876 GAGAGGCTATGGTGGGAGGATGG - Intergenic
1166563365 19:43747953-43747975 GAGCAGAGAAGGAGGGAGGAGGG - Intronic
1166573109 19:43811720-43811742 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1166674635 19:44732510-44732532 GGGTATGTATGGAAGGAGGATGG + Intergenic
1166876727 19:45902152-45902174 GATAGGAAATGGAGGGAGGATGG + Intronic
1166914009 19:46181900-46181922 GACCAGATCTGGAGGGAGAAAGG - Intergenic
1167637425 19:50662819-50662841 GGGAAGAAATGGAGGGAGCAAGG + Intronic
1167695108 19:51010516-51010538 GAGGAGAGAGGCAGGGAGGATGG - Intergenic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168228127 19:55011211-55011233 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1168465002 19:56595047-56595069 GAGAAGAGACGGAGGGAGGAAGG - Intergenic
1168468234 19:56621104-56621126 GATCAGAGAGGGAGGGAGGAGGG - Intronic
925188838 2:1867059-1867081 GGGGAGAGAGGGAGGGAGGAAGG + Intronic
925466473 2:4110924-4110946 AAGAAGAAAGGGAGGGAGGAAGG - Intergenic
925791015 2:7488538-7488560 AAGGAGATAGGAAGGGAGGAAGG + Intergenic
925791049 2:7488654-7488676 AAGTAGAAAGGAAGGGAGGAAGG + Intergenic
926153845 2:10439704-10439726 GAGCAAATGTGTAGGGAGGAAGG - Intergenic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
926266852 2:11330921-11330943 GAGGAGAGGAGGAGGGAGGAAGG + Intronic
926386111 2:12337369-12337391 GAGTATAAATGGTGGGAGCAGGG + Intergenic
927044859 2:19266994-19267016 GTGCTGATATGGGGGGAGGATGG - Intergenic
927469858 2:23365182-23365204 GAGAAGAGAGGGAGGGAGGGAGG + Intergenic
927981049 2:27375461-27375483 GGGTAGATTAGGAGGGAGAATGG - Intronic
928194602 2:29206187-29206209 GAGAAGAAAGGGAGGGAGGGAGG - Intronic
928213056 2:29338075-29338097 GACCAGCTATGGAGGGTGGATGG + Intronic
928618238 2:33060581-33060603 GGTGAGATATGGAGGGAGGCAGG + Intronic
929334236 2:40721368-40721390 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
929339792 2:40801504-40801526 GTGGAGCTATGAAGGGAGGAAGG - Intergenic
929469784 2:42179930-42179952 GTGTACATATAGAGGGAGGGAGG + Intronic
929475448 2:42242646-42242668 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
930428236 2:51239057-51239079 AAGTAGAGAGGGAAGGAGGAAGG - Intergenic
931133413 2:59366300-59366322 GAAGAGAGAGGGAGGGAGGAAGG + Intergenic
931316613 2:61139051-61139073 GAGAAGGAAGGGAGGGAGGAGGG - Intergenic
931804047 2:65787815-65787837 GATTAGATATGGAGGGTGGGGGG - Intergenic
931948116 2:67332856-67332878 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
932114031 2:69029042-69029064 TAGTAGAGATGGAGGGGGGGGGG - Intronic
932433290 2:71687974-71687996 GAGAATATTTGAAGGGAGGAAGG + Intergenic
932605487 2:73162985-73163007 GAGGAGGTGTGGAGGAAGGAAGG + Intergenic
933124945 2:78593278-78593300 GAGGAGGGAGGGAGGGAGGAAGG - Intergenic
933124965 2:78593338-78593360 GAGGAGGGAGGGAGGGAGGAAGG - Intergenic
934113244 2:88761689-88761711 GATTGGATATGGAGTGGGGAGGG - Intergenic
934626095 2:95854385-95854407 GAGTAGGAATGGAGTGAGTACGG - Intronic
934807476 2:97246930-97246952 GAGTAGGAATGGAGTGAGTACGG + Intronic
934830034 2:97510257-97510279 GAGTAGGAATGGAGTGAGTACGG - Intronic
935134010 2:100283286-100283308 CAGAATATATGAAGGGAGGATGG - Exonic
935480558 2:103582984-103583006 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936259107 2:110943078-110943100 AAGAAGAGAGGGAGGGAGGAAGG + Intronic
936270129 2:111042829-111042851 GAGTGGAGCTGGATGGAGGATGG + Intronic
936446872 2:112602948-112602970 GACTAAAGATGCAGGGAGGATGG + Intergenic
936659794 2:114529832-114529854 GAGGACAGAGGGAGGGAGGAGGG - Intronic
936907243 2:117551203-117551225 GAGCAGAGAGGGAGGGAGAAAGG + Intergenic
937267857 2:120628373-120628395 GGGGAGAATTGGAGGGAGGAAGG + Intergenic
937404809 2:121617189-121617211 GAGGAGATAGGGAGGGAGTCAGG - Intronic
937920105 2:127122730-127122752 GAGGAGAGCTGGAGGGAGGGGGG + Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939175184 2:138739993-138740015 GAGCAGAGATAGAGGGATGAGGG - Intronic
939624280 2:144457761-144457783 GAGTAAATATGGGGGGAGATTGG - Intronic
940053063 2:149484532-149484554 GGGTAGCTATGGAGCTAGGAAGG - Intergenic
941464971 2:165814663-165814685 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
941848115 2:170151612-170151634 AAGTATTTATGGAGGAAGGAAGG + Intergenic
942543182 2:177035768-177035790 GAGGAGATCTGGTGGGAGGTGGG + Intergenic
944041202 2:195357127-195357149 GAGTACATGTGGAGAGAGAAAGG - Intergenic
944532090 2:200677209-200677231 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
944897211 2:204177521-204177543 GAGTAGGGAAGGAGGGAGGGAGG - Intergenic
944914775 2:204347251-204347273 GAGTAGATAATGAAGAAGGAAGG + Intergenic
944977830 2:205077160-205077182 GAGTAGAGAGGGAGGGAGGGAGG + Intronic
945590918 2:211730456-211730478 GAGGAGATAGGGAAAGAGGAAGG - Intronic
945725818 2:213471247-213471269 GAGAAGGTACGGAGGCAGGAGGG + Intronic
945941541 2:215956362-215956384 GATTAGATAGGTAGGTAGGAAGG - Intronic
945973691 2:216254292-216254314 GAGTAGATGTGGGAGGAGGGAGG + Intergenic
946236548 2:218327752-218327774 CAGTAGAGATGTAGGGAGGAAGG - Intronic
946254016 2:218430249-218430271 AAGGAGAAATGGAGGGAGGCTGG + Intronic
946811539 2:223530776-223530798 GAGGAGAGCTGGAGAGAGGATGG - Intergenic
947148005 2:227086287-227086309 GAGAGGAGATGTAGGGAGGATGG + Intronic
947159084 2:227193869-227193891 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947159101 2:227193936-227193958 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947960898 2:234236351-234236373 GGGTGGAAAGGGAGGGAGGAAGG - Intergenic
947998014 2:234544777-234544799 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
948132207 2:235609008-235609030 AAGAAGCTAAGGAGGGAGGAAGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948458434 2:238118001-238118023 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458442 2:238118030-238118052 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458469 2:238118129-238118151 GAGAAGGAATGGATGGAGGAGGG + Intronic
948458512 2:238118284-238118306 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458630 2:238118715-238118737 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458661 2:238118815-238118837 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458740 2:238119140-238119162 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458754 2:238119183-238119205 GAGGAGGAATGGATGGAGGAGGG + Intronic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
1169009841 20:2241356-2241378 GAGGAGGGAGGGAGGGAGGAGGG - Intergenic
1169484144 20:6012480-6012502 GATTAGATATGGAGTGAGAGTGG + Intronic
1170633915 20:18088464-18088486 AAGGAGAGAAGGAGGGAGGAAGG - Intergenic
1170985186 20:21251464-21251486 CATTAGAAATGGGGGGAGGAGGG - Intergenic
1171073829 20:22102636-22102658 GAGTAGCCATCGAGAGAGGAAGG + Intergenic
1171086055 20:22239343-22239365 GAGGAGGGAGGGAGGGAGGAAGG - Intergenic
1171498612 20:25575890-25575912 TAGATGATATGGAGGGAGGGAGG - Intronic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172298315 20:33829878-33829900 TAGTAGATAGGAAGGGAAGAAGG + Intronic
1172434458 20:34919218-34919240 GGGTAGAGATGGGGGTAGGATGG + Intronic
1172808886 20:37633133-37633155 GAGGAGATGGGGAGGGAGGGGGG + Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173222163 20:41139097-41139119 GAGGAGATTGGGAGGAAGGAAGG + Intronic
1173490141 20:43473157-43473179 GGGTAGATATGCAGGCAGGACGG + Intergenic
1173915884 20:46708782-46708804 GAGAAGACAGGGAGAGAGGAGGG - Intergenic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174763509 20:53229783-53229805 GAGGAGGGAGGGAGGGAGGAAGG + Intronic
1175238077 20:57526578-57526600 GAAAGGATAAGGAGGGAGGAGGG + Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175316766 20:58054140-58054162 GAGTAGAGAGGGAGGGAGGGAGG + Intergenic
1175369941 20:58481527-58481549 GAGGAGAGAGGGATGGAGGATGG + Intronic
1175474946 20:59265548-59265570 GAGAAGGAATGAAGGGAGGAAGG - Intergenic
1175717139 20:61262766-61262788 GAGGAGAGAGGGAAGGAGGAAGG - Intronic
1175987296 20:62770454-62770476 GGGTGAATATGGAGGGAGGTGGG + Intergenic
1176002724 20:62840227-62840249 GAGTGGATTTGGAGTGAGCAGGG - Intronic
1176349769 21:5783425-5783447 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176356583 21:5904009-5904031 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176544090 21:8181495-8181517 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176563041 21:8364540-8364562 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176742548 21:10617250-10617272 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1177179385 21:17728302-17728324 GAGTAGATATGGAGAGTGCCAGG + Intergenic
1178043934 21:28673030-28673052 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1178083476 21:29089868-29089890 GGGAAGAGAGGGAGGGAGGAAGG + Intronic
1178531817 21:33382268-33382290 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1178687725 21:34724300-34724322 GAAGAGATAGGGAGGAAGGAAGG + Intergenic
1178808589 21:35860173-35860195 GAAAAGAGAGGGAGGGAGGAAGG + Intronic
1179084952 21:38207876-38207898 GAGTAGAGAGGAGGGGAGGAGGG - Intronic
1179261659 21:39763437-39763459 GAGATGAAAAGGAGGGAGGAGGG - Intronic
1179505133 21:41835000-41835022 CAGGAGATGTGGATGGAGGAGGG + Intronic
1179650519 21:42805501-42805523 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1179876888 21:44273152-44273174 GGGAAGATGTGGAGGGTGGAAGG + Intergenic
1182253192 22:29018295-29018317 GATTGGATGTGGAGAGAGGAAGG + Intronic
1182396880 22:30042543-30042565 GAGCAGATTTGGAGGGAAAAAGG + Intergenic
1182438030 22:30343278-30343300 GAGCAGAAATAGAGGGAGGTGGG - Intronic
1182743557 22:32587309-32587331 GAGGACATAGGGAGGGAGGTGGG + Intronic
1182875984 22:33691266-33691288 GAGGAGAGAGGGAGGGAGGGAGG + Intronic
1183358236 22:37370611-37370633 GTGGAGAGAGGGAGGGAGGAAGG + Exonic
1183481165 22:38066333-38066355 GAGGAGATGCGGAGGGGGGAAGG - Intronic
1184444872 22:44541187-44541209 GAGAAGCTGGGGAGGGAGGAAGG - Intergenic
1184562969 22:45274074-45274096 GAGCAGATTTGGAGGGGAGAAGG - Intergenic
1184730283 22:46367903-46367925 GTGCAGAGAGGGAGGGAGGAAGG - Intronic
1185261778 22:49869964-49869986 GAGGAGTGAGGGAGGGAGGAAGG - Intronic
1185279093 22:49962330-49962352 GGGGAGAGAGGGAGGGAGGAGGG - Intronic
1203248958 22_KI270733v1_random:97730-97752 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
950254888 3:11496406-11496428 GAGTAGAAAGGAAGGGAGGGAGG - Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951033002 3:17903756-17903778 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951604485 3:24418070-24418092 AAGTTGATATGGGAGGAGGAGGG - Intronic
951820363 3:26803142-26803164 GAATAGAAATGGAGGTAGTATGG + Intergenic
951894720 3:27599972-27599994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
951995046 3:28718175-28718197 GAGTAGAAAAGGAAGAAGGAAGG - Intergenic
952052056 3:29395874-29395896 GGGTAAATATGGATGGAGGCTGG + Intronic
952433276 3:33246923-33246945 GAAAAGAGAGGGAGGGAGGAAGG - Intergenic
952877016 3:37954629-37954651 AAGTAAATATGCAGGGTGGATGG - Intronic
953029860 3:39172097-39172119 GGGCAGGGATGGAGGGAGGAGGG + Intergenic
953553592 3:43924191-43924213 GAGTAGACAGGGAGTTAGGACGG - Intergenic
953744801 3:45566214-45566236 GAATAGAGAAGGAGAGAGGAAGG - Intronic
954213379 3:49110911-49110933 AAGTAGATAAGGGGGCAGGATGG - Intronic
954798548 3:53173932-53173954 GGGTAGAGATGGACGGAAGACGG - Intronic
954810460 3:53244060-53244082 GAGTAAACGTGGAGAGAGGAAGG + Intronic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
955479853 3:59378597-59378619 GAGGAGGGAGGGAGGGAGGAAGG - Intergenic
955564250 3:60226672-60226694 GACTAGATATAGAGGAAGGAGGG + Intronic
955778821 3:62462336-62462358 GAGAGGAGCTGGAGGGAGGAGGG - Intronic
955878783 3:63522015-63522037 AAGTAGATCTGGAGGGACAAAGG + Intronic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955972120 3:64445806-64445828 GAGTGGAGATGGAAGGATGAGGG + Intergenic
956175188 3:66466213-66466235 TAGTAGACATGGTGGGGGGAGGG + Intronic
956240950 3:67130104-67130126 GAGTAGTAAAGGAAGGAGGAGGG - Intergenic
956353536 3:68365513-68365535 GAGGAGTTAAGGAGGGAGAAGGG + Intronic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956715972 3:72080409-72080431 GAAGAGATGGGGAGGGAGGAAGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957416935 3:79917465-79917487 GGGAAGAGAAGGAGGGAGGAAGG + Intergenic
957523774 3:81354155-81354177 GAATGGAGATGGAGGGATGATGG + Intergenic
957593761 3:82233834-82233856 GAAAAGAGATGGAGGAAGGAAGG + Intergenic
957965067 3:87311769-87311791 GAGTAGAGATGAGGGCAGGAAGG - Intergenic
958849940 3:99312468-99312490 GAGGATATAGGGAGGGAGGAGGG + Intergenic
958904489 3:99927039-99927061 GGGAAGATATGGAGTGAAGATGG - Intronic
959576747 3:107942541-107942563 GAGTAGGTATGCACTGAGGAGGG + Intergenic
959993661 3:112656841-112656863 GAGTGGAGAGGGAGGGAGAAAGG - Intergenic
960310259 3:116109751-116109773 GAGGAGGAATGGAGGGTGGAAGG + Intronic
960641029 3:119823299-119823321 GGGTAGAGATGGCGGGAGGGAGG + Intronic
960854645 3:122090743-122090765 GGGTAGTGAAGGAGGGAGGAGGG + Intronic
960891458 3:122452632-122452654 GAGGAGAGAGGGAGGGAGGGAGG + Intronic
960959535 3:123060273-123060295 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961609026 3:128121868-128121890 GAGTGGAAATTGAGGGAGAATGG - Intronic
961689111 3:128655586-128655608 GAGGAGACATGGAGGTAAGAAGG - Intronic
961730434 3:128960991-128961013 GAGGAGGAATGGAGGGTGGAAGG - Intronic
962246366 3:133797649-133797671 GAGGAGGTATGCAGGGAGAAGGG + Intronic
962506114 3:136047953-136047975 GGGTAGGGATGGAGGGAGCAAGG + Intronic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
962668227 3:137678266-137678288 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
962796203 3:138851676-138851698 GAATAGATATGGTGGGGGAAGGG + Intergenic
962905011 3:139793579-139793601 GAGTAGGTATGGAGTGGGGCTGG + Intergenic
963343278 3:144063557-144063579 GATAAGATATTGAGGGTGGAGGG - Intergenic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
963782540 3:149501335-149501357 GAGGAGAGATGAAGGGAGGGAGG - Intronic
963809818 3:149764595-149764617 GAGGAGGGAGGGAGGGAGGAAGG - Intronic
964556590 3:157946167-157946189 GAGAAGAGAGGGAGAGAGGAAGG + Intergenic
965046920 3:163590136-163590158 GAGTGGACATGGAGAGAGAATGG + Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965173085 3:165293883-165293905 GAGGAGAGAGGGAGGGAGGGGGG + Intergenic
965286876 3:166828539-166828561 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
966012220 3:175094623-175094645 AAGAAGAGATGGAGGGAGGGAGG + Intronic
966066695 3:175828985-175829007 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
966142283 3:176769735-176769757 GAGGAGGGAGGGAGGGAGGAAGG + Intergenic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966726032 3:183109397-183109419 GAGGAGAGATGGTGGGAGGGAGG - Intronic
966881214 3:184352333-184352355 TAGTAGAGAGGGAGGGAGGCTGG + Intronic
967148990 3:186630987-186631009 GAGCAGATTTGGAAGGGGGAGGG - Intergenic
967851866 3:194088418-194088440 GAAAAGAAATGGAGGGAGGCAGG + Intergenic
967986933 3:195102052-195102074 GAGGAGGAATGGAAGGAGGAAGG + Intronic
968817180 4:2828203-2828225 GAGACAATAGGGAGGGAGGAAGG - Intronic
968862801 4:3185903-3185925 GAAGAGAGAGGGAGGGAGGAAGG + Intronic
968915897 4:3496944-3496966 GACTAGATGGGGAGGGGGGAGGG + Intronic
969085099 4:4650615-4650637 GAGGAGTTAGGGAGTGAGGAGGG + Intergenic
969133553 4:5011321-5011343 GGGTGGATTTGGAGGGAGGGAGG + Intergenic
969480836 4:7446064-7446086 GAGAAGACAGGGAGGAAGGAAGG - Intronic
970559576 4:17269479-17269501 TAGTAGGTGTGGAGTGAGGAGGG - Intergenic
971004721 4:22360059-22360081 GACTAGAGAGGGAGGGAGGATGG + Intronic
971394348 4:26214679-26214701 GAGGAGAGAGGGAGGAAGGATGG + Intronic
971452277 4:26811306-26811328 GAGAAGATATGGACGAAGGGAGG + Intergenic
971630333 4:28984791-28984813 GAGTAGAAGAGGAGGGAGAAAGG - Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
971892295 4:32540580-32540602 GAGTATATATGGATGGATCATGG - Intergenic
972016102 4:34248358-34248380 GAGTAGGAAGGGAAGGAGGAGGG - Intergenic
972281464 4:37605956-37605978 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
972335673 4:38105582-38105604 GGGTGGAGAGGGAGGGAGGAAGG - Intronic
972363906 4:38355483-38355505 GAGCAGCTTTGGAGGGAGTAGGG + Intergenic
973865469 4:55108696-55108718 GAGTGGAGAGGGAGGGAGGGAGG - Intronic
974473884 4:62355153-62355175 GAGAGGAAATGGAGGGAGGGAGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974737820 4:65961567-65961589 AAGTAGAAGTGGAGGGACGATGG + Intergenic
975054917 4:69918234-69918256 GATTACATATGGAGGTAGGAAGG - Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
975934038 4:79558429-79558451 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
976380497 4:84393132-84393154 AAGAAGAGAAGGAGGGAGGAAGG + Intergenic
976400408 4:84600870-84600892 GAATGGAAATGGAGGGAGGCTGG + Intronic
976924421 4:90479566-90479588 GAGTACACATGGACAGAGGAAGG - Intronic
977655220 4:99513669-99513691 GAGAAGAAAGGGAGGAAGGAAGG - Intronic
978234575 4:106443265-106443287 GAGAAGAGAAGGAGGGAGGGAGG - Intergenic
978616662 4:110603791-110603813 GTGCAGATTTGGAGGAAGGAAGG - Intergenic
978811544 4:112854866-112854888 GAGTAGAATGGGAGGGAGGGTGG + Intronic
978896793 4:113898236-113898258 GGGTAGCCATGGTGGGAGGATGG + Intergenic
980144034 4:128958497-128958519 GAGAAGATTTGGGAGGAGGATGG + Intronic
980221135 4:129917444-129917466 AAGAATATAAGGAGGGAGGATGG + Intergenic
980500632 4:133648254-133648276 GAGTAGAGAGAGAGGGAGCAAGG - Intergenic
981574344 4:146188612-146188634 GAGTAGGCATGGAAGGTGGAAGG + Intronic
982181732 4:152754028-152754050 GAGAAGCTAAGGTGGGAGGATGG + Intronic
982392640 4:154882316-154882338 AAGGAGATAGGGAAGGAGGAAGG + Intergenic
982794702 4:159630611-159630633 GTGTTGAGTTGGAGGGAGGAAGG + Intergenic
983691044 4:170469578-170469600 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
983953949 4:173675329-173675351 GAAAAGAAAAGGAGGGAGGAAGG - Intergenic
984439761 4:179751831-179751853 GAGGAGAGAGGGTGGGAGGAGGG - Intergenic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
984803338 4:183734025-183734047 GAGGAAATAAGGAGGGAGGGAGG - Intergenic
984951375 4:185010218-185010240 GAGGAGATATGGGAGGAGGGTGG + Intergenic
985117438 4:186605555-186605577 GAGAAGAGGTGGAGGGAGGGGGG + Intronic
985122428 4:186657470-186657492 GACTAGAGATGGAGGTGGGAGGG + Intronic
985219230 4:187685223-187685245 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
985293289 4:188407795-188407817 GAGTACAAATGGGGGGAGAAGGG - Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
986078460 5:4363265-4363287 GAGGAGGGAGGGAGGGAGGAGGG - Intergenic
986193393 5:5516832-5516854 GAGGAGAAATGGAGGGTGGAAGG - Intergenic
986313344 5:6571044-6571066 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986313408 5:6571227-6571249 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986313432 5:6571297-6571319 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986313453 5:6571363-6571385 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986313513 5:6571534-6571556 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986928545 5:12790347-12790369 GAGTAGAAATAGAGAGATGAGGG + Intergenic
987198857 5:15554291-15554313 GGGGAGATATAGAGTGAGGAAGG - Intronic
987388370 5:17351966-17351988 GAGGAAATATGGAGTGAGGTGGG + Intergenic
987938444 5:24500901-24500923 GAGAAGAAGTGGAGAGAGGAGGG + Intronic
988329372 5:29815178-29815200 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
988862682 5:35300949-35300971 GAGGAAATAGGGAGGGAGGAAGG - Intergenic
989210156 5:38851286-38851308 GAGCTGAGATGGAGGGAGGGAGG - Intronic
989466889 5:41767539-41767561 GAGGAGCCATGGAGAGAGGATGG - Intronic
990528536 5:56651983-56652005 GAGTAGAGAAGGAGGGAGAAGGG + Intergenic
990634025 5:57703371-57703393 GAGGAGAGAGGGAGGGTGGAAGG - Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992089573 5:73304958-73304980 GAGTACAGAGGGAGGCAGGATGG + Intergenic
992589895 5:78283717-78283739 GAGTAAGTTTGGAGTGAGGAGGG - Intronic
994084579 5:95744033-95744055 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
994093116 5:95825919-95825941 GAGCAGGTATGGAGGAAAGAGGG - Intergenic
994151739 5:96455760-96455782 GAAAAAATATGGAGGGAAGATGG - Intergenic
994206038 5:97036581-97036603 GAGCAGAGAGGGAGGGAGGGAGG - Exonic
994736077 5:103558168-103558190 TAGTAGAAATGGAGGAAAGAGGG - Intronic
994775541 5:104032885-104032907 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
995688375 5:114796363-114796385 GAGAACATATGGACGCAGGAAGG - Intergenic
995707850 5:115003571-115003593 GGGAAGATATGGATAGAGGAGGG - Intergenic
995996318 5:118304811-118304833 AAGGAGAGATGGAAGGAGGAAGG + Intergenic
996459081 5:123720415-123720437 GAGGAGTTAAGAAGGGAGGAGGG - Intergenic
996780538 5:127181930-127181952 TAGGAGATGTGGAGGGTGGAAGG - Intergenic
996885958 5:128353981-128354003 GGGGAGACAGGGAGGGAGGATGG - Intronic
997576316 5:134980341-134980363 GAGGAGGGAGGGAGGGAGGAGGG - Intronic
997599601 5:135130292-135130314 AGGTAGATATGGAGGGAGACTGG - Intronic
997671115 5:135672867-135672889 GGGTAAAGATGGAGGGAGGAAGG - Intergenic
997907026 5:137828184-137828206 AAGGAGATATGGAGGAAGGAAGG - Intergenic
998398268 5:141833735-141833757 GAGGAGTGAAGGAGGGAGGAAGG + Intergenic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
998892102 5:146757172-146757194 GAGTGGAGAGGGAGGGAGGTAGG + Intronic
998985921 5:147756639-147756661 GAGAAGAAAAGGAGGGTGGATGG + Intronic
1001582027 5:172805436-172805458 AAGAAGATACGGAGGGAGGGAGG + Intergenic
1001624301 5:173117626-173117648 GAGGAGAGAAGGAGGGAGGGAGG - Intronic
1001652147 5:173323677-173323699 GAGTAGCCAGGGAGGAAGGAGGG - Intronic
1001791852 5:174464502-174464524 GAGTGGTTCTGGAAGGAGGAAGG - Intergenic
1001890966 5:175338195-175338217 GAGGAGAGAGGGAGAGAGGAAGG - Intergenic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002255420 5:177954751-177954773 AAGAAGAAAGGGAGGGAGGAGGG + Intergenic
1002272529 5:178082095-178082117 GATCAGATATGGAGGGTGGGGGG - Intergenic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003476079 6:6484393-6484415 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1003901600 6:10660033-10660055 CAGTAGATGTGGAGGGTGCACGG + Intergenic
1004163042 6:13231172-13231194 GAGGAGGGAGGGAGGGAGGAAGG + Intronic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1004339144 6:14792774-14792796 GAGGAGATTTGGAGGAAAGAAGG + Intergenic
1004697819 6:18050379-18050401 GGGAAGCTATGGTGGGAGGATGG + Intergenic
1004796805 6:19095403-19095425 GGGTAGATATGAATGGAGGAAGG - Intergenic
1004889891 6:20090431-20090453 GAGAAAAAATGAAGGGAGGAAGG + Intergenic
1004947243 6:20629624-20629646 GAGCAGAAATGGAGTGAGGCAGG - Intronic
1005512726 6:26525818-26525840 GAGGAGGTATGCAGGGAGAAGGG + Intergenic
1005859833 6:29891681-29891703 GAGGAGGTAGGGAGGGAGGGAGG + Intergenic
1006151602 6:31992955-31992977 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006157903 6:32025693-32025715 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006411841 6:33878348-33878370 GAGTAGATAGGAAGGGGGGGTGG - Intergenic
1006525034 6:34597002-34597024 GAGGATGTATGGAGGGAGGAGGG - Intronic
1006901523 6:37505501-37505523 TAGTAGATATAGATTGAGGAAGG + Intergenic
1006970851 6:38043503-38043525 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
1007226834 6:40321057-40321079 GGGAAGAGAGGGAGGGAGGAGGG + Intergenic
1007692318 6:43710555-43710577 GAGAAGAAATGGAGGGAGGGAGG + Intergenic
1007821722 6:44565278-44565300 GAGTAGACTTGGAGAGAAGAGGG - Intergenic
1008385099 6:50880295-50880317 GAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1008920931 6:56843689-56843711 GGGGAGAGAGGGAGGGAGGAGGG + Intronic
1009006287 6:57792651-57792673 GAGTGGAAAAGAAGGGAGGATGG + Intergenic
1010125017 6:72421480-72421502 GAGATGACATGGTGGGAGGAAGG + Intergenic
1010298657 6:74232087-74232109 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1011031413 6:82927877-82927899 CAGTAGTTGTGGGGGGAGGAAGG + Intronic
1011126699 6:84015363-84015385 GATTAGAAAGGGAGGTAGGAAGG - Intergenic
1011716406 6:90109655-90109677 AAGCAGGTTTGGAGGGAGGATGG - Intronic
1011771090 6:90674660-90674682 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1012240129 6:96861725-96861747 ACTTAGATATGGATGGAGGAAGG - Intergenic
1012315675 6:97780855-97780877 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1012587654 6:100944052-100944074 GAGAAGATAGGGAGGGAGACAGG + Intergenic
1013308326 6:108870613-108870635 AAGAAGAGAGGGAGGGAGGAAGG + Intronic
1013628849 6:111965154-111965176 AAGGAGAGATGAAGGGAGGAAGG + Intergenic
1013661864 6:112306233-112306255 GAGAAGAGATGGAGGGAGGGAGG - Intergenic
1013808285 6:114017150-114017172 AAGTAGGAATGGAGGGTGGAAGG + Intergenic
1013916907 6:115351233-115351255 GAGTAGCAAGGTAGGGAGGACGG + Intergenic
1013917581 6:115360574-115360596 GATTAGAGATGGAAGGATGATGG - Intergenic
1014803822 6:125807109-125807131 CATTAGATATGGAGGGAGAGAGG - Intronic
1016124424 6:140382850-140382872 GAGGTGATATGAAGTGAGGAGGG - Intergenic
1016388265 6:143549580-143549602 AAGCAGCTATGGAGGGAGAAAGG + Intronic
1016441407 6:144087933-144087955 GAGGAGACATGGAGGAAGCAAGG + Intergenic
1016581598 6:145634366-145634388 AGGTAGATGTGGAGGGAGAAAGG - Intronic
1016818155 6:148322950-148322972 AAGTAGAGAGGGAGGGAGGGAGG - Intronic
1016902418 6:149115495-149115517 GAGTAGGTCAGGAAGGAGGAAGG + Intergenic
1017050645 6:150390610-150390632 CAGCACCTATGGAGGGAGGAAGG - Intronic
1017328636 6:153170384-153170406 GAGAAGAGATGAAGGGAGAAGGG + Intergenic
1017331538 6:153204434-153204456 GTGTAGATGTGGAGTGAGAAAGG + Intergenic
1018225533 6:161625364-161625386 GAGAACATATGGACAGAGGAAGG + Intronic
1018457772 6:163967959-163967981 GAGGAGATATTGATGGAGAAAGG + Intergenic
1018639007 6:165889902-165889924 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639021 6:165889946-165889968 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639042 6:165890020-165890042 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018665516 6:166132908-166132930 GAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1018816811 6:167339002-167339024 GAGTAGAAAAGGAGGAAGGAGGG - Intronic
1019549258 7:1594055-1594077 GAGGATAGATGGAGGGAGGGAGG - Intergenic
1019549614 7:1595416-1595438 GAGGATGGATGGAGGGAGGATGG - Intergenic
1020614063 7:10436922-10436944 GAGTATAGATGGAGTGAAGATGG - Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021710390 7:23410460-23410482 GGGTAAACATGGAGGGAGCAGGG + Intronic
1022004346 7:26253783-26253805 GACAAGAAAGGGAGGGAGGAAGG + Intergenic
1022531636 7:31070396-31070418 GAGCAGACTTGGAGGGAGGAGGG + Intronic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1022832035 7:34077284-34077306 GAGAAGATATGGAGTTAGGAAGG + Intronic
1023427093 7:40049213-40049235 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1023575497 7:41622064-41622086 GAGAAGGAATGGAGGGAGGGAGG + Intergenic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1024585194 7:50836005-50836027 GAGTGTATGTGGAGGGAGAAAGG - Intergenic
1024773930 7:52759910-52759932 AAGAAGAAATGGAAGGAGGAGGG + Intergenic
1025789867 7:64679615-64679637 GAGGAGGAATGGAGGGTGGAAGG - Intronic
1025992835 7:66508587-66508609 AAGTAGGGAGGGAGGGAGGAAGG - Intergenic
1026078930 7:67199930-67199952 GAGAAGAGAGGGAGGGAGGATGG + Intronic
1026123240 7:67556097-67556119 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
1026133124 7:67636739-67636761 AGGGAGATAGGGAGGGAGGAAGG - Intergenic
1026136351 7:67664897-67664919 GGGTAGTTATGGAGTTAGGAAGG - Intergenic
1026178210 7:68016312-68016334 AAGGAAAGATGGAGGGAGGAAGG - Intergenic
1026229205 7:68468720-68468742 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1026466669 7:70660436-70660458 GCGTAGATTTGGAGAGAAGAAGG + Intronic
1026591724 7:71702128-71702150 GAGTAGAGAGAGAGGGAGGAGGG + Intronic
1026670070 7:72382605-72382627 GAGGAGAAAGGGAGGGAGGTGGG - Intronic
1026693446 7:72570456-72570478 TAGTAGAGATGGGGGGAGGGGGG - Intronic
1026697890 7:72612009-72612031 GAGAAGAGAGGGAGGGAGGATGG - Intronic
1026814688 7:73501368-73501390 GACTACAGAAGGAGGGAGGATGG - Intronic
1027481445 7:78702700-78702722 GATTAGATTTGGAGGTAGAAAGG + Intronic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1028924740 7:96345572-96345594 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1029011763 7:97269565-97269587 GAGTAGATGTGGGGGTAGGTAGG + Intergenic
1029027759 7:97435480-97435502 GATGAGAGAGGGAGGGAGGAAGG + Intergenic
1029252569 7:99247579-99247601 GAGTAGGTCTGGTGGGAGGGAGG - Intergenic
1029354780 7:100043719-100043741 AAGTAGATATGGAGGGTGGGAGG - Intergenic
1029634164 7:101772846-101772868 GAGTATTTAAGGAGGGAGGGAGG + Intergenic
1030031098 7:105370281-105370303 TAGTAGATAGGGTGGGAGAAAGG - Intronic
1030675328 7:112379120-112379142 GAGAAGATATAAAGAGAGGAAGG - Intergenic
1031201521 7:118693858-118693880 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1031296462 7:120010130-120010152 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031318472 7:120288986-120289008 GAGTATATATGGGGGGAGAGAGG + Intronic
1031345779 7:120664456-120664478 GAGAAGAAATGAAGGGAGGAAGG + Intronic
1031419212 7:121529622-121529644 AAGAAGAGAGGGAGGGAGGAAGG - Intergenic
1031422611 7:121568466-121568488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031737322 7:125382616-125382638 GATTAGATATGGAAGAAGAAAGG - Intergenic
1031913500 7:127541512-127541534 CAGTACATATGGAGGTAGAAGGG - Intergenic
1032743923 7:134766829-134766851 GGGCAGACAGGGAGGGAGGAAGG + Intronic
1033250176 7:139751962-139751984 AAGAAGAAAAGGAGGGAGGAAGG + Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033667780 7:143459175-143459197 GAGGATATCTGGATGGAGGAAGG - Intergenic
1034995129 7:155572146-155572168 GAGGAAAGATGGAGGGAGGGAGG + Intergenic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035776256 8:2191160-2191182 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1036402322 8:8420391-8420413 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1036505046 8:9347477-9347499 GAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1036571135 8:9980558-9980580 GAGGAGGGATTGAGGGAGGAGGG - Intergenic
1036663023 8:10720530-10720552 GAAGAGAAAGGGAGGGAGGAAGG + Intergenic
1037018073 8:13933194-13933216 CAGAAGATGTGGTGGGAGGAAGG - Intergenic
1037457342 8:19076774-19076796 GAGAAGGAAGGGAGGGAGGAAGG - Intronic
1037933283 8:22897320-22897342 GCACAGATATGGATGGAGGAGGG + Intronic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038240528 8:25803682-25803704 GAGCAGGTAGGGAGGGATGAGGG + Intergenic
1038332014 8:26616603-26616625 GAGTAAATATCCAGGGAGCAGGG + Intronic
1039416770 8:37401907-37401929 AAGTAGATATGGCATGAGGAGGG - Intergenic
1040593926 8:48819784-48819806 GAGGAGCTATGGAGCTAGGAAGG + Intergenic
1040908885 8:52497997-52498019 GATGAGATATGTAGGGTGGAGGG + Intergenic
1041279711 8:56197860-56197882 GCTTAGCTATGGAGGGAGCAGGG + Intronic
1041301319 8:56414839-56414861 CAGCAGATATTGAGGGAGGGAGG - Intergenic
1042705111 8:71658760-71658782 GAGTAAATATGGAGTCAGCATGG - Intergenic
1042794757 8:72649445-72649467 GAGTAGGGAGGAAGGGAGGAAGG + Intronic
1043014178 8:74917906-74917928 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1043635051 8:82375011-82375033 AAGCAGGTGTGGAGGGAGGAAGG + Intergenic
1043918685 8:85955259-85955281 GAGTGGAGAAGGAGGGAGGGGGG + Intergenic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044587742 8:93883820-93883842 GAGTGGATGTGGAGGCAGCAAGG - Intronic
1044900297 8:96936969-96936991 GAGGAGAGAGGGAGGAAGGAAGG - Intronic
1045007556 8:97929413-97929435 GAGTAGAGAATGGGGGAGGAGGG + Intronic
1045487103 8:102640346-102640368 AAGGAGAAATGGAGGGAGGGAGG + Intergenic
1045882777 8:107060853-107060875 GAGTTGATAAGGTGTGAGGAAGG + Intergenic
1045993360 8:108335730-108335752 AACAAGAAATGGAGGGAGGAGGG - Intronic
1047511620 8:125520288-125520310 GAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1047597314 8:126392065-126392087 GAGAAGAGAGGGAGAGAGGAAGG + Intergenic
1047928599 8:129704405-129704427 GAGGAGAGAAGGAGGTAGGAAGG - Intergenic
1048135331 8:131741972-131741994 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1048365666 8:133736281-133736303 AGGGAGAGATGGAGGGAGGAAGG - Intergenic
1048690358 8:136955876-136955898 GGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049510942 8:143026370-143026392 GAACAGATCCGGAGGGAGGAGGG + Intergenic
1049801584 8:144520211-144520233 GAGTAGGAATGGTGTGAGGAAGG - Intronic
1050719382 9:8568318-8568340 TAGTAGAGAGGGAGGGAGGGAGG - Intronic
1052191681 9:25670174-25670196 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1052329003 9:27248135-27248157 GAATAGATATGGAGGGAGAGGGG + Intergenic
1052730575 9:32280504-32280526 GAGAAGGTAGGGAGGGAGGTGGG - Intergenic
1052820175 9:33132228-33132250 GAGGAGGGAGGGAGGGAGGACGG + Intronic
1052989213 9:34508979-34509001 GAATGAATAAGGAGGGAGGAAGG - Intronic
1053057872 9:35004719-35004741 GAGGAGGAATGGAGGGTGGAAGG - Intergenic
1053073953 9:35116831-35116853 GTGTTGATATGGAGTTAGGAGGG + Intergenic
1053946349 9:43312797-43312819 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1054790925 9:69255962-69255984 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
1054877167 9:70109023-70109045 GACTGGATAAGGAAGGAGGATGG + Intronic
1055283319 9:74699799-74699821 GAGCAGTGATGGAGGGAGAATGG + Intergenic
1055356993 9:75447936-75447958 GAGAAGAGAAGGAGGGAGGATGG - Intergenic
1055819316 9:80242802-80242824 AAGGAGGTAGGGAGGGAGGAAGG - Intergenic
1056548404 9:87631994-87632016 GAGTATATATGTAGAGATGAAGG + Intronic
1056548408 9:87632022-87632044 GAGTATATATGTAGGGATGAAGG + Intronic
1056548419 9:87632205-87632227 GAGTATATATGTAGGGATAAAGG + Intronic
1056548435 9:87632342-87632364 GAGTACATATGTAGGGATGAAGG + Intronic
1056548452 9:87632482-87632504 CAGTATATATGTAGGGATGAAGG + Intronic
1056548456 9:87632538-87632560 GAGTATACATGTAGGGATGAAGG + Intronic
1056548460 9:87632566-87632588 GAGTATACATGTAGGGATGAAGG + Intronic
1056548467 9:87632622-87632644 CAGTATATATGTAGGGATGAAGG + Intronic
1056548478 9:87632734-87632756 GAGTATATATGTAGGGAAGAAGG + Intronic
1056548486 9:87632818-87632840 GAGTACATATGTAGGTATGAAGG + Intronic
1056548491 9:87632874-87632896 GAGTATACATGTAGGGATGAAGG + Intronic
1056548506 9:87633018-87633040 GAGTATATATGTAGGGATGAAGG + Intronic
1056548518 9:87633157-87633179 GAGTATATATGTAGGGATGAAGG + Intronic
1056548522 9:87633185-87633207 CAGTATATATGTAGGGATGAAGG + Intronic
1056548525 9:87633213-87633235 GAGTACATATGTAGGGATGAAGG + Intronic
1056885745 9:90442221-90442243 GATGAGATATGGAGGGTGGGGGG - Intergenic
1056917128 9:90755786-90755808 GACAAGTGATGGAGGGAGGATGG - Intergenic
1056965179 9:91159418-91159440 GAGGAGCGAAGGAGGGAGGAAGG + Intergenic
1056965190 9:91159467-91159489 GAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1056986871 9:91371523-91371545 AAGGAGAGATGGAGGGAGGGAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1058961104 9:109993718-109993740 GAGAAGAAAGGGAGAGAGGAAGG - Intronic
1059095960 9:111415032-111415054 GAGGAGAGAGGGTGGGAGGAGGG + Intronic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059308439 9:113372603-113372625 GAATAGGTTTGGAGGGAGGGGGG - Intergenic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1059675819 9:116538173-116538195 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
1059750734 9:117244793-117244815 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1060563302 9:124566669-124566691 GAGGAGAGATGAAGAGAGGAGGG + Intronic
1060834238 9:126743033-126743055 GAGTAGATATAGAGGCATTAAGG - Intergenic
1061187180 9:129061349-129061371 GAGCAGGTGTGGAGGGAGGGAGG + Intronic
1061942547 9:133891398-133891420 GAGGGGAGATGGAGGGGGGATGG + Intronic
1061980421 9:134100087-134100109 TTGAAGATATGGATGGAGGAAGG - Intergenic
1062143959 9:134978790-134978812 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062143966 9:134978817-134978839 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144003 9:134978929-134978951 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144028 9:134978997-134979019 GAGGAGAGAGGGAGGGAGGGAGG + Intergenic
1062144060 9:134979105-134979127 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1062364410 9:136202140-136202162 GCGGAGAGAGGGAGGGAGGAAGG - Intronic
1062449195 9:136608413-136608435 GAGGTGAGAGGGAGGGAGGAGGG + Intergenic
1203465356 Un_GL000220v1:80981-81003 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1203583401 Un_KI270746v1:37255-37277 GAGTAGGAATGGAGTGAGTAGGG + Intergenic
1203589479 Un_KI270747v1:41355-41377 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1185708519 X:2282872-2282894 GGGGAGAGAGGGAGGGAGGAGGG + Intronic
1185843694 X:3417197-3417219 AGGAAGAGATGGAGGGAGGAAGG - Intergenic
1186157578 X:6741623-6741645 AGGTAGATAGGGAGGGAGGGAGG + Intergenic
1187483249 X:19677590-19677612 GAGAAGATATTTGGGGAGGAAGG - Intronic
1187552955 X:20324201-20324223 GAGAAGAGAAGGAGGGAGGGAGG - Intergenic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1188019993 X:25146554-25146576 GAGCAAAGATGGAGAGAGGATGG - Intergenic
1188705699 X:33326856-33326878 CAGGAGATATGGAGGGGGGATGG + Intronic
1189202272 X:39206818-39206840 GATTAGACATGGAGGGAGAGAGG + Intergenic
1189624685 X:42883898-42883920 GAGTAAAGAAGGAGGGAGAATGG - Intergenic
1189756642 X:44278628-44278650 GAGTCTATAGGGAAGGAGGAAGG - Intronic
1190472439 X:50796428-50796450 GAGTGGAAATGGTGGGAGGTGGG + Intronic
1190753234 X:53380272-53380294 GGGCAGGTATGTAGGGAGGAGGG - Intronic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1192105821 X:68315282-68315304 AAGGAGGTAGGGAGGGAGGAAGG + Intronic
1192145333 X:68678362-68678384 GAGTAAAAAGGGAAGGAGGAAGG + Intronic
1192510204 X:71716869-71716891 GAGGAGGTGTGGGGGGAGGAGGG + Intronic
1192516493 X:71764684-71764706 GAGGAGGTGTGGGGGGAGGAGGG - Intronic
1192940960 X:75911459-75911481 GATTTGTTTTGGAGGGAGGAAGG + Intergenic
1193170472 X:78329881-78329903 GAGTAGATATGTAATGAAGATGG - Intergenic
1193272084 X:79541059-79541081 GAGGAGGGAGGGAGGGAGGAAGG - Intergenic
1193320999 X:80121055-80121077 AAGTAGATATGGAGGGATGCAGG - Intergenic
1193786587 X:85767081-85767103 GAGAACACATGGAGAGAGGAAGG - Intergenic
1194091008 X:89581877-89581899 GAAAATATATTGAGGGAGGATGG - Intergenic
1194173520 X:90618131-90618153 GAGGAGGTATGGAGGGAGAGGGG - Intergenic
1194480452 X:94415318-94415340 GAGTAGATATCCACAGAGGATGG + Intergenic
1195060534 X:101189936-101189958 TAGTAGAGACGGGGGGAGGAGGG + Intergenic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195343462 X:103926498-103926520 GAGGGGATATGGATGGAGCAGGG + Intronic
1195428955 X:104766426-104766448 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
1195882912 X:109611327-109611349 GAGTAGAGGAGGAGGGAGAAAGG + Intergenic
1196210944 X:112995029-112995051 GATTGGATATGGAAGGAGGTTGG + Intergenic
1196468667 X:115999367-115999389 GAGTAGAGATGGAAGGGGGTAGG - Intergenic
1196519544 X:116656883-116656905 GGGTAGATATTAAGGGAGGTGGG + Intergenic
1196933228 X:120702731-120702753 GAGTGGAAAGGGTGGGAGGAGGG + Intergenic
1196975357 X:121152833-121152855 GAGTAGATGGGTAAGGAGGAGGG - Intergenic
1196992850 X:121347466-121347488 GAGGAGGAATGGAGGGTGGAAGG + Intergenic
1197651597 X:129071523-129071545 GGGGAGAAATGGAGGGAGGGAGG + Intergenic
1197827241 X:130602809-130602831 GAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1198269465 X:135041631-135041653 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1198421387 X:136473140-136473162 GGGGAGAAATGAAGGGAGGAAGG + Intergenic
1198518667 X:137431198-137431220 GAGATGATAGGGAGGGAGCAGGG - Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1200443656 Y:3237940-3237962 GAAAATATATTGAGGGAGGATGG - Intergenic
1201303076 Y:12526963-12526985 GAGTAGCTTTGGAGGGAGTAGGG - Intergenic
1201740886 Y:17323891-17323913 GAGAACATATGGACAGAGGAAGG + Intergenic
1201741219 Y:17326096-17326118 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic