ID: 1073215924

View in Genome Browser
Species Human (GRCh38)
Location 10:101836160-101836182
Sequence GTTGGACGCGTGCCCCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073215924_1073215932 27 Left 1073215924 10:101836160-101836182 CCACCGGGGGGCACGCGTCCAAC No data
Right 1073215932 10:101836210-101836232 TCCCCGACCTGCCCCATCCAGGG No data
1073215924_1073215931 26 Left 1073215924 10:101836160-101836182 CCACCGGGGGGCACGCGTCCAAC No data
Right 1073215931 10:101836209-101836231 CTCCCCGACCTGCCCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073215924 Original CRISPR GTTGGACGCGTGCCCCCCGG TGG (reversed) Intronic