ID: 1073215924 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:101836160-101836182 |
| Sequence | GTTGGACGCGTGCCCCCCGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073215924_1073215932 | 27 | Left | 1073215924 | 10:101836160-101836182 | CCACCGGGGGGCACGCGTCCAAC | No data | ||
| Right | 1073215932 | 10:101836210-101836232 | TCCCCGACCTGCCCCATCCAGGG | No data | ||||
| 1073215924_1073215931 | 26 | Left | 1073215924 | 10:101836160-101836182 | CCACCGGGGGGCACGCGTCCAAC | No data | ||
| Right | 1073215931 | 10:101836209-101836231 | CTCCCCGACCTGCCCCATCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073215924 | Original CRISPR | GTTGGACGCGTGCCCCCCGG TGG (reversed) | Intronic | ||