ID: 1073219498

View in Genome Browser
Species Human (GRCh38)
Location 10:101858318-101858340
Sequence AGCTCCATCCTGCTGCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073219498_1073219502 8 Left 1073219498 10:101858318-101858340 CCAGTTAGCAGCAGGATGGAGCT 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1073219502 10:101858349-101858371 CTGTTTGTTCATCTTTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073219498 Original CRISPR AGCTCCATCCTGCTGCTAAC TGG (reversed) Intronic
900099808 1:956999-957021 CGCTCCATCCTCCTCCTCACTGG + Exonic
902037826 1:13470486-13470508 AGCTCCATCCTGCACCTTAGGGG + Intergenic
904398805 1:30242049-30242071 GGCTCCTTCCTGCTGCTAGGTGG + Intergenic
905266010 1:36754939-36754961 AGCTCCAAGCAGCTGCTGACAGG - Intergenic
906644201 1:47461810-47461832 AACTCCCTCCTGCTGCTTCCAGG - Intergenic
910794552 1:91084860-91084882 ACCTCCTTCCTTCTCCTAACTGG + Intergenic
917371316 1:174297447-174297469 AGGTTCCTCCTGCTGCAAACAGG + Intronic
920077563 1:203348239-203348261 ACCTCCCTCCTGCTGCTGGCAGG - Exonic
920195856 1:204226597-204226619 AGCCCCATCCTGCAGCCAAAAGG - Intronic
920848568 1:209613146-209613168 AGCACCAGCCTGCTGCCAGCGGG + Exonic
924824631 1:247526484-247526506 TGCTCCATCCTTCTGGAAACTGG + Intronic
1065424302 10:25583050-25583072 GGCTCCAATCTGCTGCTCACAGG + Intronic
1067137555 10:43624713-43624735 AGCCCCATCCTGAAGCTACCTGG + Intergenic
1067521814 10:47013609-47013631 AGCTCCAGCATGCTGGAAACTGG + Intergenic
1068668614 10:59701795-59701817 AGCTGCCTCCAGCTACTAACAGG - Intronic
1068787954 10:60997860-60997882 AGCTCCTTACTGCTGTTGACTGG + Intronic
1069565928 10:69463434-69463456 GGCCTCATCCTTCTGCTAACTGG - Intronic
1073219498 10:101858318-101858340 AGCTCCATCCTGCTGCTAACTGG - Intronic
1073961451 10:108934758-108934780 ACCTCAATTCTGCTACTAACCGG + Intergenic
1074033852 10:109717962-109717984 TGCTCCTTCCTGCTGCTTATGGG - Intergenic
1074508662 10:114093935-114093957 AGGTCCATCCTGGTGCCAACAGG + Intergenic
1074687076 10:115971293-115971315 AGCCCCATCATGATGCTCACAGG - Intergenic
1075596000 10:123729544-123729566 CTCTCCATAGTGCTGCTAACTGG - Intronic
1077674267 11:4183157-4183179 AGCTCCCTCCTGCTACCACCTGG + Intergenic
1078196966 11:9144312-9144334 AGCTCCTCCCTGCTGCTCACAGG + Intronic
1078425345 11:11245152-11245174 AGCTCCATGATGCTGCCAATTGG - Intergenic
1079386794 11:19987578-19987600 AGCCACATTCTGCTGCAAACAGG - Intronic
1080622372 11:33997377-33997399 AGTTTCATTCTTCTGCTAACAGG - Intergenic
1081323006 11:41714182-41714204 ACCCCCATCCTGATGCTATCTGG + Intergenic
1084082596 11:66838415-66838437 AGCTCCAGGCTGCTGTTATCAGG - Exonic
1085455266 11:76661878-76661900 AGCTCTGCCCTGCTGCTCACTGG - Intronic
1085526597 11:77167614-77167636 AGCACCATGCTGTTGCTAAGGGG - Intronic
1087797735 11:102472345-102472367 GGATACATTCTGCTGCTAACAGG - Intronic
1091693789 12:2614402-2614424 TGCTCCATGATGCTCCTAACTGG - Intronic
1091900630 12:4141278-4141300 ATCTCCATCCTCCTGCTTCCTGG + Intergenic
1092860338 12:12714716-12714738 AGCGCCATCCTTCTGCAAAGTGG - Intergenic
1094299609 12:28947966-28947988 AGCTCCATCAATCTGCTGACAGG + Intergenic
1095192052 12:39269613-39269635 AGCTCCATCTTGTTGCTATGTGG - Intergenic
1097842847 12:64338812-64338834 AACTCGAGCCTGCTGCTCACCGG - Intronic
1102619048 12:114179138-114179160 AGCTACTTCCTGCTGGTCACAGG - Intergenic
1105421556 13:20256870-20256892 AGCTCCATCTTGCTCCTGTCTGG + Intergenic
1106475762 13:30096741-30096763 AGCCCCATCCTGAGGCTACCTGG + Intergenic
1107244098 13:38271779-38271801 AGCTACAACTTGCTGCTACCCGG - Intergenic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1117340155 14:54785355-54785377 AGCTCCCTCCTGGTACTAAGCGG + Intronic
1117880550 14:60309144-60309166 ATCTCCATCCCACTGCTATCAGG + Intergenic
1125271803 15:37947375-37947397 GGCCCCATCCTGCCCCTAACTGG + Intronic
1125535527 15:40439803-40439825 AGCTCCTTCCCGCACCTAACAGG + Intronic
1130584527 15:85170783-85170805 CCCTCCATCCTGCTCCAAACTGG + Intergenic
1132372130 15:101306518-101306540 GGCTCCACCCTGCTGCTTGCTGG + Intronic
1134559055 16:15191835-15191857 AGTTTCATCCCTCTGCTAACTGG - Intergenic
1134919591 16:18103448-18103470 AGTTTCATCCCTCTGCTAACTGG - Intergenic
1136410951 16:30076583-30076605 GGCTCCATCCTGCTCCTCTCTGG - Intronic
1136569923 16:31090629-31090651 AGCTCGCTCCTGCTGCCCACAGG - Intronic
1138206135 16:55126596-55126618 AGCTGCATCTTGCTGCCAGCAGG - Intergenic
1139286915 16:65823613-65823635 AGCTCCTCTCTGCTGCTCACTGG + Intergenic
1140154292 16:72406741-72406763 AGAACCATTCTGCTGATAACAGG - Intergenic
1140639765 16:76958344-76958366 AGCCCCACCCTGCCTCTAACCGG - Intergenic
1141049498 16:80747616-80747638 AGCTCAATCCTGATGCTAGAAGG - Intronic
1144387310 17:14760873-14760895 AGCTCAACTCTGCTGCTGACTGG - Intergenic
1151338522 17:73455316-73455338 GGCTCCATCCTCCTGCCCACAGG + Intronic
1152007402 17:77691224-77691246 GGCTCCAACCTGCTTCTAAGCGG - Intergenic
1155110396 18:22708906-22708928 AGCCCCATCTTCCTGCTGACTGG + Intergenic
1157211754 18:45748854-45748876 ATCTCCATGCTGCTGCCAAAAGG - Intronic
1157885645 18:51363877-51363899 TGCTCCATCCTGATGCTCAAAGG + Intergenic
1161328575 19:3675423-3675445 AGCTCCAGCCTGCAGCAGACTGG - Intronic
1161715494 19:5873952-5873974 TCCTCCTTCCTGCTGCTACCTGG - Intronic
1166142167 19:40811044-40811066 AGGTTCATCCTGCAGCCAACAGG - Intronic
1166185354 19:41135750-41135772 AGGTTCATCCTGCAGCCAACAGG + Intergenic
1168075670 19:53979902-53979924 AGCGCCATCCTGCTGCTGCTCGG + Exonic
1168645406 19:58056166-58056188 ATCCCCATCCTGCAGCCAACAGG + Intergenic
926004779 2:9365318-9365340 AGCTCCTCCCTGATGTTAACTGG - Intronic
928016028 2:27657807-27657829 AGTTTCATCCTGCTGCTATCTGG + Intronic
930749557 2:54920144-54920166 ATTTCCTTCCTTCTGCTAACAGG - Intronic
934502120 2:94869908-94869930 GGCTCCAGCCTGCTGCCATCTGG + Intergenic
936082634 2:109445198-109445220 AGCTCCAAACTACTTCTAACAGG + Intronic
937135191 2:119545575-119545597 TCCTCCATCCCTCTGCTAACAGG - Intronic
937862153 2:126719536-126719558 AGTTTCATCCAGCTGCAAACTGG - Intergenic
939575146 2:143886841-143886863 AGCCCCATCCTGAAGCTACCTGG - Intergenic
941254593 2:163212924-163212946 AGATCCATCCTGCTGCTACATGG - Intergenic
943747401 2:191476680-191476702 AGGTCCATCCTTCTGATAACTGG + Intergenic
944425995 2:199583770-199583792 ATCTGGGTCCTGCTGCTAACTGG + Intergenic
945266991 2:207900351-207900373 AGCTCCAACCTGGTGCTGTCTGG - Intronic
948511192 2:238466391-238466413 TCCTCCATCCTGCTGTTACCTGG - Intergenic
1169207620 20:3749091-3749113 AACTCCAACCTGCTCCTGACTGG - Intronic
1171071010 20:22068499-22068521 ATCTCCATCCTGGTGATCACTGG + Intergenic
1172230612 20:33333354-33333376 GCCTCCATCCTGCTGCTCCCAGG - Intergenic
1172794893 20:37529876-37529898 CCCACCATCCTGCTGCTTACAGG + Intergenic
1174063229 20:47846749-47846771 AGCTCCAACCAGCAGATAACGGG + Intergenic
1174151577 20:48489780-48489802 AGCTCCAACCAGCAGATAACAGG + Intergenic
1174257856 20:49271620-49271642 ACAACCATCCTGCTGCTTACTGG - Exonic
1174572331 20:51510814-51510836 ACCTCGATCCGGCTGTTAACAGG + Intronic
1176623888 21:9075257-9075279 GGCTCCAGCCTGCTGCCATCTGG - Intergenic
1179713868 21:43277815-43277837 AGCCTCGTCCTGCTGCTGACTGG - Intergenic
1182941759 22:34283618-34283640 AGCTTAATTCTGCTGCTAACTGG - Intergenic
1184981667 22:48099961-48099983 AGATCCATCCAGCTGCTCAGAGG + Intergenic
949184441 3:1173217-1173239 AGTCCAATTCTGCTGCTAACTGG + Intronic
950995820 3:17494813-17494835 GTCTCCAGCCTGCTGCTAGCTGG + Intronic
951688874 3:25374558-25374580 AGCTCCCTGCTGCTCCTAACTGG + Intronic
952133725 3:30393921-30393943 AGCTCCAGCCAGTTGCTGACAGG - Intergenic
954149397 3:48649958-48649980 AGCTCCTTCCTGCTGCTTGGGGG - Intronic
955412339 3:58663861-58663883 AGCTCCATGCCTCTGCTCACAGG + Intronic
955760357 3:62273603-62273625 AGTTTAATTCTGCTGCTAACAGG - Intronic
960995698 3:123338838-123338860 TGTTCCATCTTGCTGCCAACAGG + Intronic
961475470 3:127143293-127143315 AGCTTCATCCCTCTGCTACCAGG - Intergenic
963941949 3:151104546-151104568 GTCTCCATGCTGCTGCTAAATGG + Intronic
967640842 3:191861358-191861380 AGCTCCATCCTGCCCCTCACAGG - Intergenic
973741781 4:53925700-53925722 AGCTTCAGCCTGCTGCAAAGAGG - Intronic
977716043 4:100184978-100185000 AGCCCCATCCTGAAGCTACCTGG + Intergenic
983361852 4:166735776-166735798 AGCACCATCCTGCTGACATCTGG + Intronic
985043530 4:185916912-185916934 AGCCCCATCCTGTAGCTACCTGG - Intronic
985139322 4:186822355-186822377 AGCCCCATCCTGAAGCTACCTGG + Intergenic
985712554 5:1437698-1437720 AGCTGCTCCCTGCTCCTAACTGG - Intronic
986151374 5:5133188-5133210 AACTCCATCCTGCTGCTGGGGGG - Intergenic
986707243 5:10462161-10462183 AGCCCCATCCTGAAGCTACCTGG + Intronic
991585452 5:68197041-68197063 CACTCCTTCCTGCTGCTGACTGG - Intronic
993464710 5:88230859-88230881 AGCTCCATCCTGCAGCTATCTGG - Intronic
995217724 5:109614366-109614388 TGGGCCATCCTGCTGCCAACTGG - Intergenic
996623373 5:125538114-125538136 AGCCCCATCCTGAAGCTACCTGG + Intergenic
996883780 5:128331583-128331605 AGCTTCCTCCTGCTGCTACGTGG + Intronic
999651823 5:153775500-153775522 AGCTTCACCCTGCAGCTTACCGG + Intronic
1001982330 5:176045792-176045814 CGCCCCATCCTGCTGCCAACAGG - Intergenic
1002235131 5:177798265-177798287 CGCCCCATCCTGCTGCCAACAGG + Intergenic
1002443142 5:179274651-179274673 AGCCCCATCCTGTTGCTGGCTGG + Intronic
1002492177 5:179586429-179586451 AGCACCCCCCTCCTGCTAACAGG - Intronic
1002562012 5:180088862-180088884 AGCCCCATCCTGGAGCTACCTGG + Intergenic
1002758584 6:184203-184225 AGCTCCACCCTGCAGCTTCCAGG + Intergenic
1004608140 6:17213131-17213153 CTCTCCATCCTTCTGCCAACAGG + Intergenic
1004877301 6:19968652-19968674 AGGTCCATCCTCTTGCTGACCGG + Intergenic
1005549512 6:26898846-26898868 AGCCTCATCCTGCTGCCAGCTGG + Intergenic
1018891557 6:167986490-167986512 AGGTCCCGCCTGCTGCTATCGGG + Intergenic
1019660989 7:2223954-2223976 AGCTCCAGCCACCTTCTAACAGG - Intronic
1020676660 7:11192031-11192053 GGCTCCTCCCTGCTGCAAACAGG - Intergenic
1020922971 7:14288314-14288336 AGCTCTATACTGCTGCAACCTGG + Intronic
1023347475 7:39286193-39286215 AGCCCCATCTTGCTGGTAAGTGG - Intronic
1024089550 7:45923964-45923986 AGCCCACTCCTGCTGCTAAAGGG + Intergenic
1026301112 7:69098810-69098832 AGCCCCATCATGCTGGTAACAGG + Intergenic
1029585615 7:101468896-101468918 AGCTCCATCTAGCTGCTTAATGG - Intronic
1030544203 7:110872247-110872269 ACCTCCATGCTTCTGCTACCTGG + Intronic
1030909819 7:115233326-115233348 TGCTCCATCCTGTTTCTACCTGG - Intergenic
1031972886 7:128076687-128076709 TCCTGCATCCTGATGCTAACAGG - Intronic
1032437533 7:131912422-131912444 AGTTCCATTCTGCTGCTTAGTGG - Intergenic
1033601634 7:142892869-142892891 AGCTCCATCCTGCCTATAGCTGG - Intergenic
1034377100 7:150655723-150655745 AGCTGCTTCCTGCTGGTCACGGG + Intergenic
1037294613 8:17387018-17387040 ATCTCCCCACTGCTGCTAACCGG + Intronic
1037672444 8:21026832-21026854 TGCTCCATCCTTTTCCTAACAGG - Intergenic
1042791723 8:72615109-72615131 AGCTCCATGCTCCTGCTTTCTGG - Intronic
1046029690 8:108768721-108768743 AGCTCCTACCTGCTGCTCTCAGG + Intronic
1049785884 8:144450551-144450573 TGCTCCTTCCTGCTGCTCAAGGG - Exonic
1049972442 9:833191-833213 AGCTCAAAGATGCTGCTAACTGG + Intergenic
1051908632 9:22127043-22127065 AGCTCCAACTGGCTGCTAATTGG - Intergenic
1052744433 9:32426339-32426361 AACTCAATCCTGCTGCTCAGGGG - Intronic
1061989496 9:134151101-134151123 AGCTCCATCCTGCTGCCCCATGG - Intronic
1062007083 9:134244765-134244787 AGCTCCATCATGCAGGTAACAGG + Intergenic
1203747073 Un_GL000218v1:45685-45707 GGCTCCAGCCTGCTGCCATCTGG - Intergenic
1203563032 Un_KI270744v1:73795-73817 GGCTCCAGCCTGCTGCCATCTGG + Intergenic
1186969580 X:14826246-14826268 AGCACCATACAGCTGCTAAAAGG + Intergenic
1187830265 X:23374113-23374135 AGCTCCATCCTGCTGCGACATGG + Intronic
1195255387 X:103084756-103084778 ATCTCCATCTTGCTGCTGATGGG + Exonic
1196461492 X:115936238-115936260 AGCACCATGCTGCTGCTGCCAGG + Intergenic
1196975986 X:121158199-121158221 AGCTCAAACCTGCTTCTGACAGG - Intergenic
1201160394 Y:11160680-11160702 GGCTCCAGCCTGCTGCCATCTGG - Intergenic