ID: 1073224087

View in Genome Browser
Species Human (GRCh38)
Location 10:101901707-101901729
Sequence CTACAGAAGGGAGGCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073224078_1073224087 13 Left 1073224078 10:101901671-101901693 CCTGGGTGTGGATACTGTGGCAG 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1073224087 10:101901707-101901729 CTACAGAAGGGAGGCTTGAGAGG No data
1073224076_1073224087 24 Left 1073224076 10:101901660-101901682 CCTATAAGAAGCCTGGGTGTGGA 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1073224087 10:101901707-101901729 CTACAGAAGGGAGGCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073224087 Original CRISPR CTACAGAAGGGAGGCTTGAG AGG Intronic
No off target data available for this crispr