ID: 1073229839

View in Genome Browser
Species Human (GRCh38)
Location 10:101959728-101959750
Sequence TCTGGCTCCGCTAATGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073229839 Original CRISPR TCTGGCTCCGCTAATGCCTG TGG (reversed) Intronic
901054637 1:6443507-6443529 TATGGCTCCCCTGATTCCTGCGG + Intronic
905787860 1:40772221-40772243 GCTGGCTCCGTCAAAGCCTGGGG + Intergenic
905935853 1:41823622-41823644 TCTGGGATCGCTTATGCCTGTGG - Intronic
912827044 1:112915123-112915145 ACTGGCTCAGCTAAGCCCTGAGG + Intronic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
918689852 1:187466564-187466586 TTTGGCTCCCCTAATCCCTGTGG - Intergenic
1067235090 10:44440116-44440138 CCTGGCTCCCCTCATGCCTCAGG - Intergenic
1068367908 10:56076444-56076466 TTTGGCTCCCCTCATTCCTGTGG + Intergenic
1069725231 10:70573317-70573339 ACTGGCTCCTCTAGTGCCAGAGG - Intergenic
1073156520 10:101351472-101351494 TCTGGCTCAGGTAATGAATGAGG - Intergenic
1073229839 10:101959728-101959750 TCTGGCTCCGCTAATGCCTGTGG - Intronic
1073550491 10:104395994-104396016 CCAGGCTCCACTGATGCCTGAGG + Intronic
1079324948 11:19483887-19483909 TCTGGCTCTGCTGCTTCCTGGGG - Intronic
1082783752 11:57305186-57305208 TCTGTCTCCTCCTATGCCTGTGG + Intronic
1083936566 11:65872726-65872748 GCTGGCTCGGGCAATGCCTGCGG + Exonic
1088558831 11:111091564-111091586 TCTGGCTCAGCTCCTTCCTGAGG + Intergenic
1088699829 11:112401720-112401742 TCTGTCTCTGCAAATGCTTGAGG + Intergenic
1088908536 11:114172820-114172842 TCTGGCTCCTCCCATGCCAGAGG - Intronic
1095976424 12:47943440-47943462 TCTGGTTCCTCTAATGCCCATGG - Intergenic
1099096918 12:78385726-78385748 TCTGACTCAGCGAATGCCTCAGG + Intergenic
1099412152 12:82344433-82344455 TCTGGCTCTGGTAATTCCTTTGG - Intronic
1100790715 12:98127058-98127080 TCTGGCTCCGTTAATGTTGGTGG - Intergenic
1101160384 12:101967996-101968018 TCTGGCTCCATTAATGACTATGG + Intronic
1106456892 13:29935568-29935590 TCTTGCTCCGCCACTGCATGGGG - Intergenic
1114557030 14:23567902-23567924 TGTCTCTCCGCTAAAGCCTGAGG - Exonic
1116795121 14:49381963-49381985 TCTGGCTGGCCTACTGCCTGGGG - Intergenic
1118758221 14:68860899-68860921 TCTGGAGCCGCTAATCCCTGGGG - Intergenic
1118788478 14:69066802-69066824 TCTGGCTCTTCAAAGGCCTGAGG - Intronic
1124048056 15:26169189-26169211 TCTGCCTCAGCAACTGCCTGTGG - Intergenic
1124080886 15:26494820-26494842 TCTGGATCCTCAAATTCCTGAGG + Intergenic
1125278680 15:38021411-38021433 TGTGGCTCCACTATTCCCTGGGG + Intergenic
1126959509 15:53975741-53975763 TCTGGCTCAGCTTATGTCTTGGG + Intergenic
1136529497 16:30858257-30858279 TCTGGGTCCGCTAATGACTTAGG - Intronic
1139034380 16:62925773-62925795 TCTGGTTCTACTACTGCCTGGGG + Intergenic
1141869843 16:86777597-86777619 TCTGGATCTGCAATTGCCTGTGG + Intergenic
1146695167 17:34903340-34903362 TATGGCTCCCCTACTGCATGGGG - Intergenic
1147997886 17:44371089-44371111 GCTGGCTCAGCTGTTGCCTGAGG - Intergenic
1149813004 17:59696106-59696128 TCTGGCTCAGGTAATTTCTGAGG - Exonic
1156117955 18:33809692-33809714 TCTGTCTCCACTATTGCCTTTGG - Intergenic
1161135100 19:2614984-2615006 TCTGGCTCTGCCAATGGCTACGG - Intronic
1161336127 19:3714561-3714583 TCTGTCTCCCCTAAAGACTGTGG - Intronic
1163376059 19:16931258-16931280 TCTGTCCCCGCAAGTGCCTGAGG + Intronic
1165231813 19:34392068-34392090 TCTGGGTCTGTTAATGTCTGAGG + Intronic
928314854 2:30237098-30237120 TCAGGCTCGGCTCAGGCCTGGGG + Intronic
931018820 2:58018617-58018639 TCTGACTCCTCTAATTCCTCTGG + Intronic
934674050 2:96237051-96237073 TCTCCCTCAGCTCATGCCTGTGG + Intergenic
936243908 2:110810035-110810057 TCTGGTTCAGCTACTGGCTGGGG + Intronic
937244303 2:120482655-120482677 TCTGGCTCTGTTGATGCCTCAGG - Intergenic
942893290 2:181018091-181018113 TTTGGCTTCACTTATGCCTGTGG + Intronic
948300663 2:236904434-236904456 TCTGGCTCTACTGATGCTTGGGG - Intergenic
948537715 2:238658521-238658543 TCAGGCTCTGCCATTGCCTGTGG - Intergenic
948939309 2:241188136-241188158 GCTGGCTCTGCTAATGCCTGAGG - Intergenic
1168989435 20:2081447-2081469 TCTGGTTCTGCCAATTCCTGAGG + Intergenic
1173638578 20:44582679-44582701 TCTGCCTCCGCTTCTGACTGAGG + Exonic
1173684753 20:44915327-44915349 TGTGGCTCCACTCATCCCTGTGG - Intronic
1178429231 21:32504508-32504530 TCTGGCTCTGCTAATTCATGAGG - Intronic
1179585794 21:42373411-42373433 GCTGGCTCCGGCGATGCCTGGGG - Intronic
1182423715 22:30260941-30260963 TTTGGCTCCCAAAATGCCTGGGG - Intergenic
954615444 3:51966931-51966953 TCTGGCTCCCCCAACGACTGCGG + Intronic
955124246 3:56094480-56094502 TCTGGCTCTGCTAGGACCTGGGG + Intronic
959823636 3:110767304-110767326 GGTGGCTGAGCTAATGCCTGGGG + Intergenic
961981015 3:131078581-131078603 TCTACCTCTGGTAATGCCTGAGG + Intronic
962342773 3:134598976-134598998 GCTGGCTCCTCTCTTGCCTGAGG - Intronic
963853835 3:150234045-150234067 TCTGGCTCTGTTATGGCCTGAGG + Intergenic
969824060 4:9742858-9742880 TTTGGCTCTGCTAATTCATGAGG - Intergenic
977600548 4:98929692-98929714 CCTGGCTCAGCTAATGCTGGTGG + Intronic
978561306 4:110036533-110036555 TCTGGGTCTGCAAATGCATGTGG + Intergenic
979676703 4:123417294-123417316 TCTGTCTCCTCTAGTGCCAGAGG - Intergenic
982133079 4:152247729-152247751 TCTGGCTCCGGGAATGCGGGCGG - Intergenic
983041191 4:162929754-162929776 TCTGTCTCCACTAATGAATGGGG - Intergenic
984474013 4:180214757-180214779 TCTAGCTCTGCTACTTCCTGAGG + Intergenic
1000142666 5:158421215-158421237 TCAGGCTGCCCTAATGCATGGGG - Intergenic
1001135602 5:169100075-169100097 TCTGGCACTGCTAATGCTGGGGG + Intronic
1006731608 6:36240232-36240254 TCTGGCTCCACTCGTGCCTGTGG + Intergenic
1006830137 6:36963555-36963577 TCTGCCACCGCTAATGCCACGGG + Exonic
1009886151 6:69626324-69626346 TCTGGGAAGGCTAATGCCTGAGG - Intergenic
1012889982 6:104886486-104886508 TCAGGCTCCTCTCCTGCCTGAGG + Intergenic
1017771427 6:157647625-157647647 TGTGGCCCTGCTAATGACTGAGG + Intronic
1018275076 6:162121766-162121788 GCTGGCTCAGCTCATACCTGTGG + Intronic
1018765310 6:166928208-166928230 TGTGTCTCCTTTAATGCCTGCGG + Intronic
1025252846 7:57363413-57363435 CCTGGCTCAGCTCAGGCCTGGGG + Intergenic
1025873119 7:65453567-65453589 GCTGGCTCTGCTCATGGCTGTGG + Intergenic
1027530435 7:79324022-79324044 TCTGGCTCCACTACTTCCTCTGG + Intronic
1028486193 7:91359976-91359998 TCTGTCTCCTCTACTGCATGAGG + Intergenic
1029484144 7:100828967-100828989 TCTGTCCCCGCTAATTACTGTGG - Intronic
1030940297 7:115638613-115638635 TGTGGCTCCGCCATTTCCTGGGG + Intergenic
1031999060 7:128252984-128253006 TGTGGCTCAGCTAATCGCTGAGG - Intronic
1038635469 8:29283206-29283228 TCTGGCTCTGCCTTTGCCTGTGG - Intergenic
1049084706 8:140469804-140469826 TCTGCCTCCGCTGATCTCTGAGG + Intergenic
1049608082 8:143538948-143538970 TCTGGCTCTGCCAGTGCCTCAGG - Exonic
1050026300 9:1337820-1337842 TCTGGCTCTGATAATGTATGTGG + Intergenic
1050802840 9:9637560-9637582 TGTGGTTCCCCTAATGCCTTGGG + Intronic
1056498515 9:87185112-87185134 TCTTGGTCCTCTAATTCCTGAGG + Intergenic
1056869906 9:90267844-90267866 TCTTTCTCAGCTCATGCCTGAGG - Intergenic
1056870861 9:90276856-90276878 TCTGGCTCCAGTGATGTCTGTGG - Intergenic
1059130441 9:111742341-111742363 TCTGGATCCTCTACTGGCTGAGG + Intronic
1061602058 9:131676799-131676821 GCTGACTAGGCTAATGCCTGTGG - Intronic
1196521600 X:116680206-116680228 TCTGGCTCGGCTCATACTTGGGG - Intergenic
1197765538 X:130057312-130057334 CCTTGCTCCACTCATGCCTGGGG + Exonic