ID: 1073233626

View in Genome Browser
Species Human (GRCh38)
Location 10:101994344-101994366
Sequence CCTCCTTTTCACAAGATTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073233626 Original CRISPR CCTCCTTTTCACAAGATTAG GGG (reversed) Intronic
900915994 1:5639027-5639049 TCTGCTTTCCACAAGAGTAGTGG - Intergenic
901898571 1:12337554-12337576 CCTCCTTTTGACAAAATTGTTGG + Intronic
902120594 1:14161926-14161948 CCTCCTTCTCACACGAACAGTGG + Intergenic
902514732 1:16984000-16984022 CCTCCTTTTTTCAAGGGTAGGGG - Intergenic
907022974 1:51086851-51086873 ACTCCACTTCACAAGATTATGGG - Intergenic
907713069 1:56902413-56902435 CATCCTTTTGAAAATATTAGAGG - Intronic
910433002 1:87177311-87177333 CCTCCTTTCCAGAAGACAAGTGG - Intergenic
915002976 1:152610365-152610387 CCTCCCATGTACAAGATTAGGGG + Intergenic
916039726 1:160951691-160951713 CCTCCTGTTCACAAGCTTGCAGG + Intronic
916549497 1:165836540-165836562 CCTGCTTTCTACAAAATTAGAGG - Intronic
917168382 1:172140850-172140872 CATCTTTTTAACAAGTTTAGGGG - Intronic
922956980 1:229611305-229611327 CCTCCTGTTTACAAGAGGAGTGG + Intronic
1062792100 10:314296-314318 GGTCCTTTTCCCAAGATCAGTGG - Intronic
1067225458 10:44373340-44373362 CCTCCTGTTGACAAGAACAGAGG + Intronic
1069085296 10:64131812-64131834 CTTTCTTTTCACATGATTAGAGG - Intergenic
1069323397 10:67201711-67201733 CCTCCATTTCACATGTTTAAAGG + Intronic
1071235290 10:83639188-83639210 CTTCCTTTCCCCAAGATTAAAGG - Intergenic
1072007596 10:91268701-91268723 CCTCAATTTCTCAAGAATAGTGG + Intronic
1072357403 10:94624850-94624872 CTGCCTTTTCACAAGAGCAGAGG - Intergenic
1073077446 10:100833100-100833122 CCTCCTCTTCACATGATTGAGGG - Intergenic
1073233626 10:101994344-101994366 CCTCCTTTTCACAAGATTAGGGG - Intronic
1073516972 10:104085162-104085184 CCTACTTTTCTTTAGATTAGAGG + Intronic
1074435819 10:113433321-113433343 CCTCCTTTCCAGAAGCTTTGGGG + Intergenic
1076463674 10:130663920-130663942 CTTCCTTTTCACAAGAATGATGG - Intergenic
1080394089 11:31874052-31874074 ACTCCTTTCCAAAAGAGTAGGGG - Intronic
1080480825 11:32648046-32648068 CCTACTTTGCAGAAGATTGGAGG - Intronic
1082027587 11:47584231-47584253 CCTACTTTTCACAAGGCTATTGG - Intronic
1083555201 11:63620588-63620610 CCTCCTTATCACAAGAGGAATGG - Intergenic
1086167407 11:83795514-83795536 CATCCTTTTCACAATAATATTGG + Intronic
1088216959 11:107521547-107521569 CTTCCGTTTCTCTAGATTAGGGG - Intronic
1090411375 11:126512075-126512097 CCTCCATTTCATGAGATGAGGGG + Intronic
1096475291 12:51905970-51905992 CCACCTTTTGACAGGAATAGAGG - Intergenic
1102643113 12:114383787-114383809 CCTCCTTTTTACAAGGTCAAGGG - Intronic
1103858202 12:123989522-123989544 ACTCCTTTTCCCTACATTAGTGG - Intronic
1104577879 12:129984471-129984493 CCTCCTTTTCTGAATATTAGAGG - Intergenic
1105062456 12:133165592-133165614 CCATCTTTTCACATGTTTAGTGG - Intronic
1109341971 13:61074094-61074116 TGTCCTTTTCACAAAATTATAGG + Intergenic
1112311496 13:98321185-98321207 CCTCCATTCCACAAGGTCAGTGG - Intronic
1112451215 13:99511986-99512008 CTTCCTTTTCCCTAGACTAGTGG + Intronic
1113451424 13:110412861-110412883 CCTCCTTTCCACAAGTCTGGTGG + Intronic
1113753787 13:112794469-112794491 CCTCCTTTTGACAATAGTAGTGG + Intronic
1115185464 14:30683413-30683435 CCACCTTTTCACATGGGTAGGGG - Intronic
1116645864 14:47528134-47528156 CATCCTTTTCACAAGAACTGAGG + Intronic
1118152479 14:63204593-63204615 CCTCATTTTCACAGAATTCGAGG - Exonic
1119489220 14:75016059-75016081 GCACCTTTTCACATGATTTGTGG - Exonic
1120726141 14:87943736-87943758 CCTCCTTTTCCCACAATAAGTGG + Intronic
1123927054 15:25125587-25125609 CTTCCTTCTTACATGATTAGTGG + Intergenic
1124077423 15:26459572-26459594 TCTCCTTTTCTCAAGATCAATGG - Intergenic
1128239344 15:66090644-66090666 CGTCCTTTTTCCAAGATTCGTGG - Intronic
1129980096 15:79861168-79861190 CCTCATTTTCAAATGATCAGAGG + Intronic
1130381463 15:83375856-83375878 CTTGCATTTCCCAAGATTAGTGG - Intergenic
1131254018 15:90849795-90849817 CCTCTTTTTCATATGATTATTGG - Intergenic
1131701852 15:94945477-94945499 ACCACTTTTCAAAAGATTAGTGG - Intergenic
1131741258 15:95395189-95395211 ACTCTTTTTAACAAGATTTGAGG - Intergenic
1132223159 15:100119936-100119958 CCTCCATTTCATAAGGTTAGTGG - Intronic
1135149681 16:19994806-19994828 CTTCCTTTCCACAAGGTCAGAGG + Intergenic
1139502425 16:67377937-67377959 CCGCCTTTTCTTAACATTAGAGG + Intronic
1139514946 16:67447321-67447343 CCTCTTTTTCAGGAGATGAGAGG + Intronic
1140157535 16:72447695-72447717 CCTCCTTTTCACATTTTTGGAGG + Intergenic
1144440150 17:15273889-15273911 ACTCCTTTTCACAATATTGAGGG - Intergenic
1149962924 17:61131858-61131880 CCTCCTTTTCAAAAGCTCAGAGG - Intronic
1151059390 17:71073714-71073736 CCTCCTGTTCCCAAGATTGTTGG + Intergenic
1158289974 18:55929558-55929580 CCTCAATTTCACAATATTATTGG - Intergenic
1163223544 19:15938809-15938831 CCTGCTTTACAGAATATTAGAGG + Intergenic
926672304 2:15587858-15587880 CTTCCCTATCACATGATTAGTGG + Intergenic
927444148 2:23142882-23142904 CCTCCTTCTCCCAAGATAAAGGG + Intergenic
927460300 2:23292949-23292971 CCTCCTCTTCCCAAAATGAGGGG + Intergenic
931659364 2:64544171-64544193 CATCCTTATCAGGAGATTAGGGG - Intronic
932878689 2:75478922-75478944 CTTCCTTTTGACAAGAGAAGAGG - Intronic
933259744 2:80119004-80119026 CCTCTTTTTAATCAGATTAGAGG + Intronic
933440442 2:82306516-82306538 CTTCCTTTTCATAAGAGTTGGGG - Intergenic
933882188 2:86680850-86680872 CTGCCTTTTCACAAGGGTAGTGG + Intronic
934967082 2:98731842-98731864 TCGCCGTTTCACAAGGTTAGAGG + Intergenic
935455382 2:103261520-103261542 CCTCCTGTTCACAGCATTATTGG + Intergenic
937260716 2:120585452-120585474 CCTCCCTCTCAGAAGATTGGGGG - Intergenic
940395060 2:153179290-153179312 ACTCCTTTTCACAACATAAAAGG + Intergenic
942257797 2:174123396-174123418 TCTTCTTTCCAAAAGATTAGTGG + Intronic
942872883 2:180756831-180756853 CCTCTTTTTGGCAACATTAGCGG + Intergenic
944157165 2:196619642-196619664 CCTCCTCTTCCCAAGATGATTGG - Intergenic
945940000 2:215939334-215939356 CCACCTGGTCACAAGATTATGGG - Intergenic
946224185 2:218253909-218253931 CCTCTTATTCCCAAGATTAGCGG - Exonic
948137982 2:235651388-235651410 CCTCATTTTGACAAGCTTAAGGG + Intronic
1170139275 20:13109582-13109604 CCTCTTTTTCAAAATATTTGGGG - Intronic
1172588306 20:36100336-36100358 CCACCTTGTCCCCAGATTAGAGG + Intronic
1173566816 20:44045663-44045685 CCACCTTTTCATAAGTTTACTGG - Intronic
1178518132 21:33265900-33265922 CCTCTTTTTAACTTGATTAGTGG - Intronic
1183970053 22:41469749-41469771 TCACCTTTGCACAAGATTTGAGG + Intronic
954915722 3:54147415-54147437 CCTCCTTTACCAGAGATTAGTGG - Intronic
957607721 3:82424493-82424515 CCTCATTTTCAAAAGAAGAGTGG + Intergenic
964883564 3:161452413-161452435 CTTCATTTTCTCAAGATCAGCGG - Intergenic
966732867 3:183164745-183164767 CCTCCTTATCACTAGATTGAGGG + Intergenic
968863749 4:3194364-3194386 CCTCCTGTTTACAACATTTGGGG + Intronic
969861674 4:10040730-10040752 ACTCCTTTTCTGAAGCTTAGGGG + Intronic
971585632 4:28402603-28402625 CTTCCTTTTCACAAGGACAGAGG + Intronic
971924446 4:32989204-32989226 ACTCCTTTCTACAAGATTAGTGG + Intergenic
976127112 4:81845448-81845470 CCTCCTCTGCATAAGATAAGGGG + Intronic
981422475 4:144567099-144567121 CCTCCTTTTCATAAACTCAGAGG + Intergenic
983248475 4:165317250-165317272 CCTAATTTTCACAACATTATAGG - Intronic
987223872 5:15819958-15819980 CCTCCTTTTCAAAACAATATTGG + Intronic
987390306 5:17369045-17369067 CCTCCTTTTCAGAAAATGACAGG - Intergenic
987937670 5:24488084-24488106 TCTTCTTTTGACAAGATCAGAGG + Exonic
987952307 5:24690911-24690933 TTTCCCATTCACAAGATTAGTGG + Intergenic
988869443 5:35372828-35372850 CTTCTTTTTCAGAAGAATAGAGG + Intergenic
993160721 5:84287619-84287641 CCTGCTTTTTACAAGATCACAGG + Intronic
994856450 5:105127187-105127209 CATACTTTTCACAAGGTTGGAGG - Intergenic
999039751 5:148394526-148394548 CATCTTTTTCTCAAGATGAGTGG - Intronic
1002480119 5:179495383-179495405 CCTCCTTTTCACAGACTGAGAGG + Intergenic
1003383488 6:5646496-5646518 CCTCCTCTTTTCAAGAGTAGAGG - Intronic
1004344919 6:14840387-14840409 TCTCTTTTTAACAAGATTATAGG - Intergenic
1004812729 6:19277418-19277440 TCTGATTTTCACAAGATTAGAGG - Intergenic
1006677449 6:35774586-35774608 CCTCCCTTGCAGAAGGTTAGAGG + Intergenic
1008322317 6:50131742-50131764 CCTCGTTTTCACAAGTTTACAGG - Intergenic
1008338009 6:50329680-50329702 CCTTATTTTCACAAGTTTATTGG - Intergenic
1008839316 6:55880745-55880767 CCTACTCTTCCCAAAATTAGAGG + Intergenic
1010661879 6:78581049-78581071 CCTCCTTGTCAAAGGATCAGTGG - Intergenic
1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG + Intronic
1018412036 6:163559606-163559628 CCTACTTTGCAGAAGATTACAGG - Intronic
1018841948 6:167523854-167523876 CCTCCTGTTCAAGAGATCAGAGG + Intergenic
1019958838 7:4439745-4439767 ACTTCTTGTCACAAGATTGGAGG + Intergenic
1021010380 7:15456530-15456552 CCTGCTATCCACAAGATCAGGGG + Intronic
1022056208 7:26737164-26737186 CCTCTTTTTCACCAGACCAGGGG - Intronic
1030007462 7:105133185-105133207 TCTCCTTTCCTCAAGAGTAGTGG + Intronic
1030324169 7:108202633-108202655 CTTCCTTTTCACAAAACTAAGGG - Intronic
1031391221 7:121217240-121217262 CCTCCTTTCCACAAGGGCAGGGG + Intronic
1034969711 7:155411328-155411350 CCTCCTTTTCCCAGGAAGAGGGG + Intergenic
1036674658 8:10820027-10820049 GATCCTTTTCATAATATTAGTGG - Intronic
1037048975 8:14345159-14345181 CCACCTTTTCATAAGTTTACGGG - Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1039203210 8:35119710-35119732 TCTTCTTTACACAAGATCAGGGG - Intergenic
1039240270 8:35548549-35548571 CCTCCATTTCCTAAGGTTAGGGG + Intronic
1039676256 8:39671458-39671480 CCTCTTTTTTAAAAGATGAGGGG - Intronic
1041702976 8:60811927-60811949 ACACCTTTTCATAAGATTAATGG + Intronic
1043999756 8:86865293-86865315 CTGCCTTTTCACAAGGGTAGAGG + Intergenic
1045160151 8:99531733-99531755 TCTCAATTGCACAAGATTAGTGG - Intronic
1045870030 8:106915925-106915947 CCTCCTTTACACAAGATGGGTGG - Intergenic
1047830526 8:128624483-128624505 CTTCCTTTTCCCAAGAACAGAGG - Intergenic
1047920426 8:129629323-129629345 CCCCCTTTTCCCTAGATGAGGGG - Intergenic
1049845180 8:144797297-144797319 CTTCCTTTTCACAAGGACAGGGG - Intergenic
1050169480 9:2800405-2800427 ACTCATTTTCTCAAGACTAGGGG + Intronic
1051345365 9:16146365-16146387 CCGCCTTTTCCCAGTATTAGTGG - Intergenic
1051983822 9:23057786-23057808 CTGCCTTTTCACAAGAGCAGAGG - Intergenic
1052503795 9:29326670-29326692 CCACCTTTTCATATGCTTAGTGG + Intergenic
1060380136 9:123161887-123161909 CCTACTTTTCAGTAGCTTAGAGG - Intronic
1061538197 9:131262352-131262374 CCTCCTGATTACAGGATTAGAGG - Intronic
1185454083 X:299015-299037 CCTCCTAGTCACATTATTAGAGG - Intronic
1186268029 X:7852766-7852788 CTTGCTTTTCACAAAATTTGGGG - Intergenic
1187110297 X:16291814-16291836 CCTCCTTCTCCCAAGGTTGGAGG + Intergenic
1192603771 X:72492325-72492347 GCACCTTTTCATAAGTTTAGTGG + Intronic
1193305594 X:79947593-79947615 TCCCATTCTCACAAGATTAGTGG + Intergenic
1193472357 X:81922519-81922541 CCTACTTTTCACAATTTTTGTGG + Intergenic
1195955145 X:110320560-110320582 GCTATTTTTCACAAGAGTAGGGG - Intronic
1196750819 X:119115899-119115921 CCTCCATTTCAGGAGACTAGGGG - Intronic
1199050632 X:143232687-143232709 CCTCCCTTTTCCAAAATTAGAGG - Intergenic
1199645317 X:149904134-149904156 CCTCCTCTGCACAAGATGAATGG + Intergenic