ID: 1073240412 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:102054286-102054308 |
Sequence | GGCTAAGGCAGAAGAATCGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1073240409_1073240412 | 0 | Left | 1073240409 | 10:102054263-102054285 | CCTGTAGTCACAGCTACTCAGAA | No data | ||
Right | 1073240412 | 10:102054286-102054308 | GGCTAAGGCAGAAGAATCGCTGG | No data | ||||
1073240408_1073240412 | 19 | Left | 1073240408 | 10:102054244-102054266 | CCAGGCATGGTGGTGCGCGCCTG | No data | ||
Right | 1073240412 | 10:102054286-102054308 | GGCTAAGGCAGAAGAATCGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1073240412 | Original CRISPR | GGCTAAGGCAGAAGAATCGC TGG | Intronic | ||