ID: 1073240412

View in Genome Browser
Species Human (GRCh38)
Location 10:102054286-102054308
Sequence GGCTAAGGCAGAAGAATCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073240409_1073240412 0 Left 1073240409 10:102054263-102054285 CCTGTAGTCACAGCTACTCAGAA No data
Right 1073240412 10:102054286-102054308 GGCTAAGGCAGAAGAATCGCTGG No data
1073240408_1073240412 19 Left 1073240408 10:102054244-102054266 CCAGGCATGGTGGTGCGCGCCTG No data
Right 1073240412 10:102054286-102054308 GGCTAAGGCAGAAGAATCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073240412 Original CRISPR GGCTAAGGCAGAAGAATCGC TGG Intronic