ID: 1073240413 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:102054300-102054322 |
| Sequence | AATCGCTGGAACCCGAGAGA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073240409_1073240413 | 14 | Left | 1073240409 | 10:102054263-102054285 | CCTGTAGTCACAGCTACTCAGAA | No data | ||
| Right | 1073240413 | 10:102054300-102054322 | AATCGCTGGAACCCGAGAGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073240413 | Original CRISPR | AATCGCTGGAACCCGAGAGA CGG | Intronic | ||