ID: 1073240413

View in Genome Browser
Species Human (GRCh38)
Location 10:102054300-102054322
Sequence AATCGCTGGAACCCGAGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073240409_1073240413 14 Left 1073240409 10:102054263-102054285 CCTGTAGTCACAGCTACTCAGAA No data
Right 1073240413 10:102054300-102054322 AATCGCTGGAACCCGAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073240413 Original CRISPR AATCGCTGGAACCCGAGAGA CGG Intronic