ID: 1073240414

View in Genome Browser
Species Human (GRCh38)
Location 10:102054303-102054325
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073240409_1073240414 17 Left 1073240409 10:102054263-102054285 CCTGTAGTCACAGCTACTCAGAA 0: 23
1: 2306
2: 52208
3: 177250
4: 230525
Right 1073240414 10:102054303-102054325 CGCTGGAACCCGAGAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr