ID: 1073242402

View in Genome Browser
Species Human (GRCh38)
Location 10:102067010-102067032
Sequence CACCCCAGGCTGCTGTAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073242402_1073242414 17 Left 1073242402 10:102067010-102067032 CCTTCCTACAGCAGCCTGGGGTG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1073242414 10:102067050-102067072 CAGCTCCAGCTAGATGGGAATGG 0: 1
1: 0
2: 4
3: 16
4: 182
1073242402_1073242410 11 Left 1073242402 10:102067010-102067032 CCTTCCTACAGCAGCCTGGGGTG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1073242410 10:102067044-102067066 GCCCTGCAGCTCCAGCTAGATGG 0: 1
1: 0
2: 1
3: 33
4: 304
1073242402_1073242416 27 Left 1073242402 10:102067010-102067032 CCTTCCTACAGCAGCCTGGGGTG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1073242416 10:102067060-102067082 TAGATGGGAATGGCAAGCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 217
1073242402_1073242412 12 Left 1073242402 10:102067010-102067032 CCTTCCTACAGCAGCCTGGGGTG 0: 1
1: 0
2: 3
3: 26
4: 222
Right 1073242412 10:102067045-102067067 CCCTGCAGCTCCAGCTAGATGGG 0: 1
1: 0
2: 4
3: 41
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073242402 Original CRISPR CACCCCAGGCTGCTGTAGGA AGG (reversed) Exonic
900522511 1:3112592-3112614 CAACCCACGCTGCTGGTGGAGGG + Intronic
900600187 1:3499547-3499569 CAGCCCGGGGTGCTGCAGGAGGG - Intronic
900949527 1:5850536-5850558 CAGCCCAGGCTTCTGTGGCAGGG - Intergenic
901456313 1:9364889-9364911 CACCCCAGGCTGGAGTGCGATGG + Intronic
902385030 1:16071673-16071695 AAGCCCAGGCTGCAGAAGGAAGG + Intronic
903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG + Intronic
903233381 1:21935263-21935285 CACCCCAGGCTGCTGGTGGTGGG - Intronic
904076860 1:27849830-27849852 CATCCTTGGCTGATGTAGGATGG + Intronic
904470307 1:30731922-30731944 CCCCCCAGTCTGCGGTAGGAGGG - Intergenic
904599428 1:31665495-31665517 CAGGCCAGGCTGGGGTAGGATGG - Intronic
905529248 1:38663647-38663669 CACCCCAGGATGTTGCAGGTAGG + Intergenic
906214944 1:44033227-44033249 CACCCCAGCCTACTGCTGGAAGG - Intergenic
908559665 1:65292966-65292988 CAAGCTAGTCTGCTGTAGGATGG - Intronic
910219537 1:84876455-84876477 CCCTCCAGGTTGCTGTAGGTTGG + Intronic
915282467 1:154831968-154831990 CAAGCCAGGATGCTGTATGATGG - Intronic
915335197 1:155136817-155136839 CAGCCCAGGTTGCTGCAGGGTGG - Exonic
916353509 1:163878631-163878653 CATCCCTGGCTGCTGAGGGAGGG - Intergenic
916666328 1:166971090-166971112 CAACCCAGCCTGCAGTGGGAAGG - Intronic
917003487 1:170386259-170386281 CACCTCTGGGTGCTGTGGGAGGG - Intergenic
919763920 1:201114581-201114603 CGCCCCAAGCTGGTGGAGGAGGG + Exonic
920674280 1:208028674-208028696 CACCCCCTGCTGCGGGAGGAAGG - Intronic
923043076 1:230333625-230333647 CACCCCAGGAAGCTGTCAGACGG + Intronic
924478583 1:244405217-244405239 CACCCCAGGCTGAAGTACGGTGG + Intergenic
1062971829 10:1654328-1654350 CACCCAAGGCTGCAGTGTGAGGG + Intronic
1066080206 10:31923089-31923111 CACCCCAGGCTGCAGTACAGTGG - Intronic
1066696239 10:38080413-38080435 CACCTTCGGCTGCTGCAGGAAGG + Intergenic
1067552954 10:47247919-47247941 TACCCTTGGCTGCTCTAGGAAGG + Intergenic
1070256111 10:74814152-74814174 CACCTCAGGCGGCTGCTGGATGG - Intergenic
1070319353 10:75343275-75343297 CAGCCCAGGCTGCTGTGGGATGG + Intergenic
1073242402 10:102067010-102067032 CACCCCAGGCTGCTGTAGGAAGG - Exonic
1073440731 10:103551143-103551165 CACCCCTGGCTTCTGCAGGGTGG + Intronic
1075448945 10:122534113-122534135 GGCCCCAGGCAACTGTAGGAGGG - Intergenic
1075722586 10:124596088-124596110 CACCCACGGATGCCGTAGGATGG - Intronic
1077011875 11:382440-382462 CACCCCAGCCTCCTCTAGGGTGG + Intergenic
1077096430 11:801055-801077 CATCCCAGGTGGCTGCAGGAGGG + Exonic
1077106661 11:845214-845236 ACCCCCAGGGTGCTGTGGGATGG + Intronic
1077273428 11:1692461-1692483 GACCCTAAGCTGCTGGAGGAGGG + Intergenic
1079008780 11:16811546-16811568 CCCCACAGGCTGCAGGAGGATGG + Intronic
1081675005 11:44963510-44963532 CACAGCAGGCTGCTGGGGGAAGG + Intergenic
1081758027 11:45558378-45558400 CATCCTCGGCTGCTGTAGGAAGG + Intergenic
1081831559 11:46120284-46120306 CACCCCGGGATGCTGTCGGGGGG - Intronic
1082020925 11:47532474-47532496 CTGCCCAGGATGCTGTAGAAGGG + Intronic
1082879020 11:58020015-58020037 CACTTCAGGCTGCTCTAGGCAGG - Intergenic
1085456214 11:76666657-76666679 CACCCCTGGCTGCTCTTAGAGGG - Intronic
1085592245 11:77774804-77774826 CACCCCAGGCTGGTGTGCAATGG + Intronic
1089073822 11:115721271-115721293 CATCCCTGTCTGTTGTAGGATGG - Intergenic
1089784548 11:120898661-120898683 CACCCCAGGATGCTGCAGCTGGG - Intronic
1098143038 12:67469969-67469991 CACCCCTGGCTGCAGCAGGGTGG - Intergenic
1103509418 12:121464483-121464505 AAACCCAGGCTGCTGAGGGAAGG + Intronic
1104040949 12:125130287-125130309 TGCCCCACGCTGCTGCAGGAAGG - Intronic
1104983696 12:132585256-132585278 CATCCCAAGGTGCTGCAGGAGGG - Intergenic
1108001911 13:45911581-45911603 CACACCAGGCTGAAGTCGGAAGG + Intergenic
1110485720 13:76039329-76039351 CACCCCAGGATCCTGAAGAAAGG - Intergenic
1113343651 13:109451867-109451889 CACCACAGGGTGCTGGAAGACGG - Intergenic
1113372878 13:109738671-109738693 TACCCCAGGATGCTCCAGGAAGG + Intergenic
1113605774 13:111604287-111604309 CATCCCAGGATGCTCCAGGAAGG - Intronic
1116992659 14:51292319-51292341 ATCCCAAGGCTGCTGTAGGAAGG - Intergenic
1118362189 14:65066012-65066034 CACCGCAGGCCTCTGAAGGAAGG + Intronic
1118765461 14:68906649-68906671 CACCCATGGCTGCTGCAGGAAGG + Intronic
1119348017 14:73942342-73942364 GAGCCCAGGCAGCTGTGGGAGGG - Intronic
1119861014 14:77936104-77936126 CACCCCAGCCTCCTCTAGGGAGG - Intergenic
1120238226 14:81917509-81917531 CACCTCCAGCTGCTGCAGGAAGG - Intergenic
1121322181 14:92998373-92998395 CACCCCAGGCATCAGCAGGAGGG - Intronic
1121643674 14:95502944-95502966 CACTCCAAGCTGCTGGAGGTCGG + Intergenic
1121891022 14:97590614-97590636 CTACCCAGGCTTGTGTAGGAAGG + Intergenic
1122744126 14:103887995-103888017 CTCCCCAAGCTCCTGCAGGATGG + Intergenic
1123055045 14:105565705-105565727 CACCCCAGCCTCCTAGAGGAGGG - Intergenic
1123079493 14:105685549-105685571 CACCCCAGCCTCCTAGAGGAGGG - Intergenic
1123125144 14:105940911-105940933 CACCCCAGGATGGGGTTGGATGG + Intergenic
1125759280 15:42085885-42085907 ACCCCCAGGCTGCAGCAGGAAGG + Intronic
1125852620 15:42919875-42919897 CACCCTGGGATGCTGTGGGAGGG - Intronic
1127260019 15:57320607-57320629 CTCCCCAGGCTGCTCTGGGGGGG - Intergenic
1127981342 15:64037509-64037531 CTCCCCAGGCTGGTGGAGAAAGG - Intronic
1128144497 15:65325206-65325228 CTCCCCAGGCTGCCCTTGGATGG + Intergenic
1129257018 15:74339401-74339423 CCCCCCAGGCTGCTGCAGCTAGG - Intronic
1131049918 15:89340808-89340830 CAGCCAAGGCTGCTGTCGGCGGG - Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1132071666 15:98783054-98783076 CTGCCTAGGCTGCTGGAGGATGG + Intronic
1132472848 16:116199-116221 CCACCCAGGATGCTGTAGGCAGG - Intronic
1133571336 16:7043209-7043231 CAACCCAGCCTGCTGAAGGACGG - Intronic
1135027651 16:19010950-19010972 GACCACAGACTGCAGTAGGAGGG - Intronic
1135853075 16:25982173-25982195 CACCCCCGGCTGCTGAAGGACGG + Intronic
1137349241 16:47696716-47696738 CACCTCAGGCTCCTCCAGGAAGG + Intronic
1141655858 16:85416273-85416295 CTCGCCAGCCTGCTGGAGGAGGG + Intergenic
1141669084 16:85482110-85482132 GGACCCAGGCGGCTGTAGGAGGG + Intergenic
1142016094 16:87748483-87748505 CGGCCCAGGCTTCTGTATGAAGG + Intronic
1142157586 16:88539692-88539714 CACCCCAGCCTGCCTGAGGAAGG + Intergenic
1142286208 16:89172504-89172526 CACCCCAGGCAGCTGCGGCAGGG - Intronic
1143995888 17:11006079-11006101 GAACCCAGGCTGCAGTAGGGAGG - Intergenic
1144737236 17:17561954-17561976 CACCCCAGGCTCCGGTGGGAGGG + Intronic
1145238925 17:21228261-21228283 CAACCCAGGCTGCTGTAGACAGG - Intergenic
1145878146 17:28335368-28335390 CAGCCCAGGCTGATGTAGACAGG + Exonic
1146450831 17:32972675-32972697 TACCCCAGGCTGATGTCTGATGG + Intronic
1146523682 17:33547607-33547629 CACTCTAGGCTTCTGCAGGATGG - Intronic
1147141050 17:38460847-38460869 CACCCCTGGCTGCTGAGGGCTGG + Intronic
1147306302 17:39566734-39566756 CACCCCAGGCAGCACTAGAAGGG + Intergenic
1147468144 17:40628445-40628467 CACCCCAGTGAGCTGTAGGAAGG + Exonic
1148633064 17:49126689-49126711 CACCCCAGGCTGGAGTACGTTGG + Intergenic
1148690647 17:49524995-49525017 CACCCCAGGCTGCAGGAGGCTGG + Intergenic
1149597960 17:57875173-57875195 CACCCCAGGCTACAGCAGGGAGG + Intronic
1151392862 17:73799492-73799514 CACACCAGGATGCTGCAGGCAGG - Intergenic
1151639240 17:75377279-75377301 CACCCCAGGCTGGAGTACGGTGG - Intronic
1152044809 17:77928968-77928990 TCCCCCAGGCTGCTGTCGAAGGG + Intergenic
1152270095 17:79319476-79319498 CTGCCCAGGCTGCTCTTGGAGGG - Intronic
1152428243 17:80230572-80230594 CAGGCCAGGCTGGTGGAGGAAGG + Intronic
1152779232 17:82219091-82219113 CACCCCAGGCAGGTGTGGGCAGG + Intergenic
1152784877 17:82242349-82242371 CACCCCAGGCGGCTGGAGTGCGG + Intronic
1153050870 18:902040-902062 TCCCCCAGGCTGCTGTGGGCAGG + Intergenic
1154329672 18:13419443-13419465 CACCCCAGCCTCCTGTAGCCTGG - Intronic
1155074050 18:22339859-22339881 AACCCCAGCCTGCTGCAGGGTGG - Intergenic
1156389162 18:36634614-36634636 CAGCCCTGGCTCCTGGAGGAAGG + Intronic
1157260674 18:46173677-46173699 CACCGCAAGCTGCTTTCGGAAGG + Intronic
1157746277 18:50138840-50138862 CAGCCCAGGCTGAGGCAGGATGG - Intronic
1160030459 18:75253481-75253503 CAGCCCAGGCTGCAGCAGCATGG + Intronic
1160562237 18:79765804-79765826 CACCCCAGGCTTCTGAAGAGAGG + Intergenic
1163105883 19:15122877-15122899 CACCCCAGGTAGGTGGAGGATGG - Exonic
1163665754 19:18603547-18603569 CTCCCCAGGCGGCTGGAAGAAGG + Intronic
1164752064 19:30664413-30664435 CAGGCCAGGCTGCTGGAGGGCGG + Intronic
1165079780 19:33300696-33300718 CACCCCAGCCTGCTATAGGCTGG - Exonic
1165959034 19:39519183-39519205 CTCCCAAGGCTGCGGTGGGAGGG + Intronic
1166853955 19:45773193-45773215 CACCCCACTCAGCTGTGGGAAGG + Intronic
1167671183 19:50854805-50854827 CTCCCCATGCTGCTGGAGGCTGG - Intergenic
1167673954 19:50873323-50873345 CTCCCCATGCTGCTGGAGGCTGG - Exonic
928113666 2:28529599-28529621 CACCCCTGGCTTCTGAAGGGTGG - Intronic
928306023 2:30171129-30171151 CAGCCCTGGCTGATGTACGATGG + Intergenic
929947079 2:46379878-46379900 CACCACAGGCTGGAGTAGGCAGG + Intronic
930032372 2:47066313-47066335 CACCCCAGGCTGTGGCATGAGGG + Intronic
932904803 2:75738351-75738373 CAAACCAAGCTGCTGTAGCATGG + Intergenic
934167532 2:89307989-89308011 CACCCCATGCTGCTGAGGAATGG + Intergenic
934199743 2:89874457-89874479 CACCCCATGCTGCTGAGGAATGG - Intergenic
935209288 2:100924616-100924638 CAGCCCTGGCTGTTGTAGGCAGG + Intronic
936251964 2:110874144-110874166 CCCCCCAGGCTGCTGAGGGTGGG - Intronic
937314686 2:120924123-120924145 CACACCAGGGTGCTGGGGGATGG + Intronic
938705443 2:133920591-133920613 CACCCCAAGCTGCAGTAAGCAGG + Intergenic
942605695 2:177688161-177688183 CATCACAGGCTGCTGTACCAAGG + Intronic
946179824 2:217942607-217942629 CACCCCAGGCAGCTTCAGGAGGG + Intronic
946199714 2:218064650-218064672 CACCCCAGGCAGCTTTAGGAGGG + Intronic
946302296 2:218831350-218831372 CCCCCAAGGCTGCTCCAGGAAGG + Exonic
947347850 2:229211811-229211833 CACTGCAGGCTACTGTTGGAAGG - Intronic
947707224 2:232286048-232286070 CACCCCAGCCTGTTGGAGCATGG - Intronic
948137548 2:235648058-235648080 CAAGCCAGGCAGCTGTAGGCTGG + Intronic
948459481 2:238122239-238122261 CACCCCTGGCTCCCATAGGAAGG - Intronic
1171210112 20:23310398-23310420 CAACCCAGGCTGGTGCAGGAGGG - Intergenic
1171303648 20:24085915-24085937 CAACCCAGGCTGGAGTACGATGG + Intergenic
1171377161 20:24701260-24701282 CACCCGGGGCTGCAGCAGGAAGG - Intergenic
1172829320 20:37819704-37819726 CTGCTCAGGCTGGTGTAGGAGGG - Intronic
1173168343 20:40701823-40701845 CACCCCCAACTGCTGTTGGATGG - Intergenic
1173865191 20:46308533-46308555 CACCAGAGGCTGCGGGAGGAAGG - Intergenic
1174256804 20:49262364-49262386 CACCCCAGGCTGCAGTGCAATGG - Intronic
1174414999 20:50360503-50360525 GACCCCAGGCTGCTGACGGAGGG - Intergenic
1175309736 20:58003491-58003513 CACCCCAGGCTGAGGCTGGAGGG + Intergenic
1175319712 20:58076602-58076624 CACCCCACCCAGCTGTGGGAGGG - Intergenic
1175935384 20:62511597-62511619 CACCGCATGCTGCAGTGGGAGGG - Intergenic
1178409299 21:32350446-32350468 CAACCCATTCTACTGTAGGAAGG + Intronic
1179116025 21:38493654-38493676 GAGCCGAGGCTGCTGGAGGAGGG - Intronic
1179423019 21:41251134-41251156 CCACCCAGGCTGGTGTAGGATGG + Intronic
1179993162 21:44959073-44959095 CACACCAGGAAGCTGTGGGAGGG + Intronic
1182886777 22:33780455-33780477 CACTCCAGGCAGCTGGAGGATGG + Intronic
1183890555 22:40924441-40924463 CATCCCAGGCTGCAGAGGGAGGG - Exonic
1183946570 22:41329645-41329667 CACCCTAGGCTTCTCCAGGAGGG - Intronic
949510369 3:4761740-4761762 CGCCCCAGGCTCCTGAAGCACGG - Intronic
953473353 3:43185072-43185094 CAACCCAGAATGCTCTAGGAGGG + Intergenic
954392031 3:50272987-50273009 CACCTTAGGCTGGGGTAGGAGGG - Intronic
954697990 3:52437563-52437585 CTCCCCAGGCTGCTGTGCGCTGG - Exonic
954962478 3:54578539-54578561 CACACCAGGCAGCTGTACTAAGG - Intronic
955406022 3:58626284-58626306 CACCCCAGGATGCTGACGCAGGG + Intronic
961091188 3:124114087-124114109 CACCTCAGGCAGCTGGATGAGGG + Intronic
961193553 3:124982747-124982769 CACCCCCGGCTGCAGATGGAAGG - Intronic
963047802 3:141116176-141116198 AGCCCCAGGCTGCTTCAGGAAGG + Intronic
963345934 3:144096770-144096792 CACCACAGGCTGCTTTTGGTTGG + Intergenic
963851761 3:150216691-150216713 CACCACAGGGTGCTGCAGGCTGG - Intergenic
966928258 3:184659445-184659467 CCCCCCAGGCGGCTGCAGGAAGG - Intronic
967106199 3:186256723-186256745 CAGGCCAGGCTGCTGGAGGCAGG - Intronic
969285206 4:6198824-6198846 CAGCCCAGGGTGCTACAGGAAGG + Intronic
969448605 4:7259947-7259969 CAGCCCAGGCTGGTGCAGGCAGG + Intronic
970583626 4:17494980-17495002 GAGCCCAGCCTGGTGTAGGAGGG + Intronic
972351076 4:38236649-38236671 CTCCCCGGGTTGCTGCAGGATGG - Intergenic
972533010 4:39977409-39977431 CGCCCTAGGCTGCTGGAGGGAGG - Intronic
973978139 4:56283516-56283538 TACACCAGGCTGCAGTGGGAGGG - Intronic
976334955 4:83874759-83874781 CACCCCAGGAAGATGTAGAATGG - Intergenic
980942998 4:139292858-139292880 CACCCCAGGCTGGAGTGGAATGG + Intronic
982108299 4:152030253-152030275 CACCAGAAGCTGCTGTAGAAAGG - Intergenic
982317139 4:154043456-154043478 CACTCAAGGCAGTTGTAGGACGG + Intergenic
983649759 4:170026414-170026436 CGGCCCAGGCTCCTGTAGGTGGG - Intronic
984528800 4:180890134-180890156 CATCTCAGGCTGCTGTAACAAGG + Intergenic
984923140 4:184783360-184783382 ACCCCCAGGCAGCTGTAGGGAGG - Intronic
984934012 4:184874169-184874191 CCCCCCGGGCTGGTGGAGGAAGG - Intergenic
985532271 5:440990-441012 CCCACCTGCCTGCTGTAGGACGG + Intergenic
985663927 5:1172096-1172118 CTCCCCAGGCTGCTGGGGGATGG - Intergenic
986929379 5:12798389-12798411 TACCCCAAGCTAATGTAGGAAGG - Intergenic
988863447 5:35308565-35308587 AACCGCAGGCTGCTGCAGGAGGG - Intergenic
989522555 5:42418737-42418759 CACCCAAGGCAGTTGTGGGATGG + Intergenic
990537419 5:56736472-56736494 GCCCCCAGGCTGCTGTGGAAAGG - Intergenic
991025115 5:62020617-62020639 CAACCCAGGCAGATGCAGGATGG + Intergenic
994428830 5:99628920-99628942 CACCCCAGGCAGCAGCAGCAAGG - Intergenic
995030446 5:107474605-107474627 CATCCCAGGATGCTATAGGTGGG - Intronic
995381147 5:111534751-111534773 CACACAAGGCTGCTGTAGGCAGG + Intergenic
997010784 5:129874997-129875019 CAGACCAGACTGCTCTAGGAGGG - Intergenic
998441255 5:142164301-142164323 CATCTCAGGCTGCTGTGGGAGGG - Intergenic
1000089242 5:157915838-157915860 CAGGCCAGGCTGCTGGAGAATGG + Intergenic
1000280099 5:159774642-159774664 CACCCCAGGCACCTGTTTGAGGG + Intergenic
1002374688 5:178780196-178780218 TGCCCCACGCTGCTGCAGGAAGG + Intergenic
1003580973 6:7340715-7340737 CACCCCAGGCTTCTGGACCAGGG + Intronic
1015006346 6:128286103-128286125 CACCACTGGCTGCTGTGGGGAGG - Intronic
1015804542 6:137095195-137095217 GACCCCTGGCTGCTGGAGCATGG + Intergenic
1016567356 6:145471569-145471591 CACTCCAGGCAGCTGCAGCATGG + Intergenic
1016808914 6:148240612-148240634 CACCCGAGGCTGCTGGTGGGTGG + Intergenic
1017014252 6:150087450-150087472 CACCCACTGCTGTTGTAGGAAGG + Intergenic
1019460687 7:1156829-1156851 CACCCCATGCTGGGGCAGGAAGG + Intronic
1019576795 7:1741463-1741485 CTCCCCAGCCTGATGGAGGAGGG + Intronic
1019660389 7:2220696-2220718 CACCCCACGCCGCTCTGGGAAGG + Intronic
1023291060 7:38669548-38669570 CAGCCCAAGCTGCAGTGGGAAGG + Intergenic
1024707673 7:51979043-51979065 CACCCTGGGCTGCTGCATGAAGG - Intergenic
1027872878 7:83732020-83732042 CACCCCTGGTTGATGCAGGAAGG - Intergenic
1029177700 7:98676515-98676537 CACCACAGCCTGTTGGAGGATGG - Intergenic
1030084248 7:105803431-105803453 CAGCCCTGGCTGCTGTGAGAAGG + Intronic
1030334297 7:108307841-108307863 CATCCCTGGCTGCTTTTGGAGGG - Intronic
1032073222 7:128822659-128822681 CATCCCAGGCTGAAGCAGGAAGG + Intergenic
1032513725 7:132491960-132491982 CACCCCAGGCTGCCCTTGGAAGG - Intronic
1033422869 7:141218546-141218568 GACCCCAGGCTGGTGTATGGTGG + Intronic
1034198036 7:149262681-149262703 CCGCCCAGCCTGCTGTAGGGGGG - Intronic
1034353572 7:150433176-150433198 AACCTCAGGCAGCTGGAGGATGG + Intergenic
1034935719 7:155199346-155199368 CACTCCAGGATGCTGGAGGCTGG + Intergenic
1035074343 7:156168679-156168701 CTCCTCCAGCTGCTGTAGGAAGG - Intergenic
1035257106 7:157637450-157637472 CTCCCCAGGCTGCTGGAGGCTGG - Intronic
1035289404 7:157827985-157828007 CACCCCAAGCTGCCGTCTGAGGG - Intronic
1038421073 8:27434356-27434378 CAGCCCAGGCTGCTGGGGGCTGG - Intronic
1048286652 8:133147018-133147040 GAGGCCATGCTGCTGTAGGAGGG + Intergenic
1049229673 8:141475456-141475478 CACCCCAGGAGGCTGGGGGAAGG - Intergenic
1049256477 8:141616761-141616783 CACCTCAGGCTGCTGTGAGGTGG + Intergenic
1049342706 8:142121810-142121832 AAACCCACGGTGCTGTAGGAAGG - Intergenic
1049562887 8:143320909-143320931 CTCCCAGGGCTGCTGGAGGAAGG - Intronic
1054190893 9:61985155-61985177 GAACCCTGGTTGCTGTAGGAAGG - Intergenic
1058705205 9:107632115-107632137 CACCACAGGCTCCTCTAGGAAGG - Intergenic
1059906433 9:118991702-118991724 AACCACAGGATGCCGTAGGAAGG + Intergenic
1060134172 9:121135828-121135850 CACCTCATGCTGCTCTTGGAGGG - Exonic
1061444727 9:130631392-130631414 CAGCGCAGCCTGCTGTGGGAAGG + Intronic
1061717857 9:132532137-132532159 CACCACAGGCTGCTGTGTGAAGG + Intronic
1061789548 9:133051865-133051887 CAGCCCAGGCTTCTGAGGGAAGG + Intronic
1061929769 9:133826507-133826529 CCTCACAGGCTGCTGTGGGAAGG - Intronic
1062344276 9:136107653-136107675 CACCCCAGCCAGGTGGAGGAGGG + Intergenic
1062444431 9:136587743-136587765 CAGCCCTCGCTGCTGTAGGATGG - Intergenic
1062502464 9:136857358-136857380 CACCCCCAGCTGCTGTTCGAGGG + Exonic
1189253497 X:39619799-39619821 CTCCCCAGCCTGCTGTCTGATGG - Intergenic
1189257429 X:39651311-39651333 CCCAGCAGGATGCTGTAGGAGGG + Intergenic
1192099423 X:68248177-68248199 CATCTCTGGCTGCTGGAGGAGGG + Intronic
1193473768 X:81939262-81939284 CACCTTAGGCTGCTGTAACAAGG - Intergenic
1193815621 X:86101793-86101815 CACCCCAGGCAGCTGTGGCTTGG + Intergenic
1196609437 X:117695025-117695047 CACCCCAGGCAGCGGAAGCATGG + Intergenic
1199440848 X:147866437-147866459 CACCCCATGCTGCTGCTGCAGGG - Intergenic
1200142795 X:153910168-153910190 TACCCCAGGCAGCTGGCGGAAGG + Exonic
1200782779 Y:7231908-7231930 CACCCAAGTCTGCTGTTGAATGG - Intergenic