ID: 1073245322

View in Genome Browser
Species Human (GRCh38)
Location 10:102086324-102086346
Sequence CCTACCCTGCACACCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073245313_1073245322 12 Left 1073245313 10:102086289-102086311 CCGGCTTCTAGAGGCCACGGCTG No data
Right 1073245322 10:102086324-102086346 CCTACCCTGCACACCCAGGAAGG No data
1073245314_1073245322 -2 Left 1073245314 10:102086303-102086325 CCACGGCTGCCACTTCCCCTCCC No data
Right 1073245322 10:102086324-102086346 CCTACCCTGCACACCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073245322 Original CRISPR CCTACCCTGCACACCCAGGA AGG Intergenic
No off target data available for this crispr