ID: 1073250431

View in Genome Browser
Species Human (GRCh38)
Location 10:102117713-102117735
Sequence AGCCACATGCTGCCCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073250423_1073250431 6 Left 1073250423 10:102117684-102117706 CCCTACTCCTCCCTGCCTTAACC No data
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250426_1073250431 -4 Left 1073250426 10:102117694-102117716 CCCTGCCTTAACCCTTCTGAGCC 0: 1
1: 0
2: 2
3: 28
4: 210
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250424_1073250431 5 Left 1073250424 10:102117685-102117707 CCTACTCCTCCCTGCCTTAACCC 0: 1
1: 0
2: 2
3: 41
4: 536
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250420_1073250431 11 Left 1073250420 10:102117679-102117701 CCTCCCCCTACTCCTCCCTGCCT 0: 1
1: 0
2: 27
3: 306
4: 2711
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250421_1073250431 8 Left 1073250421 10:102117682-102117704 CCCCCTACTCCTCCCTGCCTTAA 0: 1
1: 0
2: 0
3: 40
4: 511
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250416_1073250431 19 Left 1073250416 10:102117671-102117693 CCTCCTCCCCTCCCCCTACTCCT 0: 1
1: 6
2: 166
3: 1069
4: 6402
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250418_1073250431 13 Left 1073250418 10:102117677-102117699 CCCCTCCCCCTACTCCTCCCTGC 0: 1
1: 1
2: 40
3: 1088
4: 2990
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250425_1073250431 -1 Left 1073250425 10:102117691-102117713 CCTCCCTGCCTTAACCCTTCTGA 0: 1
1: 0
2: 0
3: 21
4: 239
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250415_1073250431 28 Left 1073250415 10:102117662-102117684 CCACTGCTGCCTCCTCCCCTCCC No data
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250427_1073250431 -5 Left 1073250427 10:102117695-102117717 CCTGCCTTAACCCTTCTGAGCCA 0: 1
1: 0
2: 4
3: 15
4: 183
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250417_1073250431 16 Left 1073250417 10:102117674-102117696 CCTCCCCTCCCCCTACTCCTCCC 0: 1
1: 5
2: 160
3: 1002
4: 5904
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250419_1073250431 12 Left 1073250419 10:102117678-102117700 CCCTCCCCCTACTCCTCCCTGCC 0: 1
1: 0
2: 23
3: 347
4: 2813
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250428_1073250431 -9 Left 1073250428 10:102117699-102117721 CCTTAACCCTTCTGAGCCACATG 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data
1073250422_1073250431 7 Left 1073250422 10:102117683-102117705 CCCCTACTCCTCCCTGCCTTAAC 0: 1
1: 0
2: 1
3: 33
4: 329
Right 1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073250431 Original CRISPR AGCCACATGCTGCCCCAGAC AGG Intronic
No off target data available for this crispr