ID: 1073252036

View in Genome Browser
Species Human (GRCh38)
Location 10:102126411-102126433
Sequence GGTACTCTGTTAGATGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073252036_1073252041 27 Left 1073252036 10:102126411-102126433 CCTCCAGCATCTAACAGAGTACC No data
Right 1073252041 10:102126461-102126483 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073252036 Original CRISPR GGTACTCTGTTAGATGCTGG AGG (reversed) Intergenic
No off target data available for this crispr