ID: 1073252039

View in Genome Browser
Species Human (GRCh38)
Location 10:102126432-102126454
Sequence TAGTTCACAAACTAGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073252039_1073252041 6 Left 1073252039 10:102126432-102126454 CCTGGAACCTAGTTTGTGAACTA No data
Right 1073252041 10:102126461-102126483 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
1073252039_1073252042 27 Left 1073252039 10:102126432-102126454 CCTGGAACCTAGTTTGTGAACTA No data
Right 1073252042 10:102126482-102126504 GGAGTCTTGCTCTGTTGCCCAGG 0: 8345
1: 35403
2: 95445
3: 137050
4: 165011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073252039 Original CRISPR TAGTTCACAAACTAGGTTCC AGG (reversed) Intergenic
No off target data available for this crispr