ID: 1073252039

View in Genome Browser
Species Human (GRCh38)
Location 10:102126432-102126454
Sequence TAGTTCACAAACTAGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073252039_1073252041 6 Left 1073252039 10:102126432-102126454 CCTGGAACCTAGTTTGTGAACTA No data
Right 1073252041 10:102126461-102126483 TTTTTTTTTTTTTTTTGAGATGG No data
1073252039_1073252042 27 Left 1073252039 10:102126432-102126454 CCTGGAACCTAGTTTGTGAACTA No data
Right 1073252042 10:102126482-102126504 GGAGTCTTGCTCTGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073252039 Original CRISPR TAGTTCACAAACTAGGTTCC AGG (reversed) Intergenic