ID: 1073252040

View in Genome Browser
Species Human (GRCh38)
Location 10:102126439-102126461
Sequence AAAGTTATAGTTCACAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073252040_1073252042 20 Left 1073252040 10:102126439-102126461 CCTAGTTTGTGAACTATAACTTT No data
Right 1073252042 10:102126482-102126504 GGAGTCTTGCTCTGTTGCCCAGG No data
1073252040_1073252043 24 Left 1073252040 10:102126439-102126461 CCTAGTTTGTGAACTATAACTTT No data
Right 1073252043 10:102126486-102126508 TCTTGCTCTGTTGCCCAGGTTGG No data
1073252040_1073252041 -1 Left 1073252040 10:102126439-102126461 CCTAGTTTGTGAACTATAACTTT No data
Right 1073252041 10:102126461-102126483 TTTTTTTTTTTTTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073252040 Original CRISPR AAAGTTATAGTTCACAAACT AGG (reversed) Intergenic