ID: 1073252041

View in Genome Browser
Species Human (GRCh38)
Location 10:102126461-102126483
Sequence TTTTTTTTTTTTTTTTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073252037_1073252041 24 Left 1073252037 10:102126414-102126436 CCAGCATCTAACAGAGTACCTGG No data
Right 1073252041 10:102126461-102126483 TTTTTTTTTTTTTTTTGAGATGG No data
1073252036_1073252041 27 Left 1073252036 10:102126411-102126433 CCTCCAGCATCTAACAGAGTACC No data
Right 1073252041 10:102126461-102126483 TTTTTTTTTTTTTTTTGAGATGG No data
1073252039_1073252041 6 Left 1073252039 10:102126432-102126454 CCTGGAACCTAGTTTGTGAACTA No data
Right 1073252041 10:102126461-102126483 TTTTTTTTTTTTTTTTGAGATGG No data
1073252040_1073252041 -1 Left 1073252040 10:102126439-102126461 CCTAGTTTGTGAACTATAACTTT No data
Right 1073252041 10:102126461-102126483 TTTTTTTTTTTTTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073252041 Original CRISPR TTTTTTTTTTTTTTTTGAGA TGG Intergenic