ID: 1073252042

View in Genome Browser
Species Human (GRCh38)
Location 10:102126482-102126504
Sequence GGAGTCTTGCTCTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073252040_1073252042 20 Left 1073252040 10:102126439-102126461 CCTAGTTTGTGAACTATAACTTT No data
Right 1073252042 10:102126482-102126504 GGAGTCTTGCTCTGTTGCCCAGG No data
1073252039_1073252042 27 Left 1073252039 10:102126432-102126454 CCTGGAACCTAGTTTGTGAACTA No data
Right 1073252042 10:102126482-102126504 GGAGTCTTGCTCTGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073252042 Original CRISPR GGAGTCTTGCTCTGTTGCCC AGG Intergenic