ID: 1073252043

View in Genome Browser
Species Human (GRCh38)
Location 10:102126486-102126508
Sequence TCTTGCTCTGTTGCCCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073252040_1073252043 24 Left 1073252040 10:102126439-102126461 CCTAGTTTGTGAACTATAACTTT No data
Right 1073252043 10:102126486-102126508 TCTTGCTCTGTTGCCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073252043 Original CRISPR TCTTGCTCTGTTGCCCAGGT TGG Intergenic