ID: 1073255121

View in Genome Browser
Species Human (GRCh38)
Location 10:102146096-102146118
Sequence CTGGAGTGTAGTAGCTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073255116_1073255121 20 Left 1073255116 10:102146053-102146075 CCAACTGGGTATGTTTTGGGGAA 0: 1
1: 0
2: 1
3: 16
4: 119
Right 1073255121 10:102146096-102146118 CTGGAGTGTAGTAGCTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073255121 Original CRISPR CTGGAGTGTAGTAGCTGATC AGG Intronic
No off target data available for this crispr