ID: 1073255121 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:102146096-102146118 |
| Sequence | CTGGAGTGTAGTAGCTGATC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073255116_1073255121 | 20 | Left | 1073255116 | 10:102146053-102146075 | CCAACTGGGTATGTTTTGGGGAA | 0: 1 1: 0 2: 1 3: 16 4: 119 |
||
| Right | 1073255121 | 10:102146096-102146118 | CTGGAGTGTAGTAGCTGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073255121 | Original CRISPR | CTGGAGTGTAGTAGCTGATC AGG | Intronic | ||
| No off target data available for this crispr | |||||