ID: 1073257342

View in Genome Browser
Species Human (GRCh38)
Location 10:102161438-102161460
Sequence CAGGAAATTCAGATCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42480
Summary {0: 1, 1: 7, 2: 298, 3: 5274, 4: 36900}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073257342_1073257347 2 Left 1073257342 10:102161438-102161460 CCCAGGCTGATCTGAATTTCCTG 0: 1
1: 7
2: 298
3: 5274
4: 36900
Right 1073257347 10:102161463-102161485 CTCAAGCGATCCTCCTACCTTGG 0: 110
1: 3015
2: 20458
3: 56719
4: 110301
1073257342_1073257352 19 Left 1073257342 10:102161438-102161460 CCCAGGCTGATCTGAATTTCCTG 0: 1
1: 7
2: 298
3: 5274
4: 36900
Right 1073257352 10:102161480-102161502 CCTTGGACTCCCAAAATGCTGGG 0: 59
1: 5812
2: 102717
3: 226459
4: 240626
1073257342_1073257353 20 Left 1073257342 10:102161438-102161460 CCCAGGCTGATCTGAATTTCCTG 0: 1
1: 7
2: 298
3: 5274
4: 36900
Right 1073257353 10:102161481-102161503 CTTGGACTCCCAAAATGCTGGGG 0: 4
1: 125
2: 1939
3: 4242
4: 5311
1073257342_1073257350 18 Left 1073257342 10:102161438-102161460 CCCAGGCTGATCTGAATTTCCTG 0: 1
1: 7
2: 298
3: 5274
4: 36900
Right 1073257350 10:102161479-102161501 ACCTTGGACTCCCAAAATGCTGG 0: 14
1: 1984
2: 37314
3: 139481
4: 233801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073257342 Original CRISPR CAGGAAATTCAGATCAGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr