ID: 1073261987

View in Genome Browser
Species Human (GRCh38)
Location 10:102197393-102197415
Sequence TCTTCCAGTAGCACTCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073261987_1073261990 -9 Left 1073261987 10:102197393-102197415 CCCTAAGGAGTGCTACTGGAAGA No data
Right 1073261990 10:102197407-102197429 ACTGGAAGACATTTGGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073261987 Original CRISPR TCTTCCAGTAGCACTCCTTA GGG (reversed) Intergenic
No off target data available for this crispr