ID: 1073266458

View in Genome Browser
Species Human (GRCh38)
Location 10:102230974-102230996
Sequence CCCTACGAGGAGGTGTACCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073266458_1073266471 27 Left 1073266458 10:102230974-102230996 CCGGGGTACACCTCCTCGTAGGG 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1073266471 10:102231024-102231046 GAAGCTGCCTTTGCATAGCTCGG 0: 1
1: 0
2: 0
3: 13
4: 139
1073266458_1073266463 -2 Left 1073266458 10:102230974-102230996 CCGGGGTACACCTCCTCGTAGGG 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1073266463 10:102230995-102231017 GGCGGCACCAGCCCCCCGAGCGG 0: 1
1: 1
2: 1
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073266458 Original CRISPR CCCTACGAGGAGGTGTACCC CGG (reversed) Exonic
904087985 1:27923407-27923429 CTCTAGGAAGAGGTGTACCCAGG + Intergenic
908937610 1:69394872-69394894 CCCTACTGGGAGGTGTCTCCTGG + Intergenic
920695586 1:208179390-208179412 CCCTGCTAGGAGGTGCAGCCGGG + Intronic
1065473024 10:26102807-26102829 CCCTACTGGGAGGTGTCTCCTGG + Intronic
1070349343 10:75576573-75576595 CCCTACTGGGAGGTGTCTCCTGG - Intronic
1073041444 10:100609750-100609772 CCCTGTGAGGAGGTGTCCCTGGG + Intergenic
1073266458 10:102230974-102230996 CCCTACGAGGAGGTGTACCCCGG - Exonic
1076784965 10:132745246-132745268 CCCAAAGGGGAGGTGTCCCCAGG - Intronic
1084274643 11:68045081-68045103 CGCTACCAGGAGGTCAACCCCGG + Exonic
1084709082 11:70832841-70832863 CCCCACGAGCAGGTGCAGCCAGG + Intronic
1085039409 11:73318042-73318064 CCCTGGGAGGAGGTTTATCCTGG - Intronic
1085319760 11:75566656-75566678 CGCGACGAGGAGGTGCACGCCGG + Exonic
1091681550 12:2531189-2531211 CGCTAACAGGAGGTTTACCCAGG + Intronic
1098073364 12:66699961-66699983 CCCTCCCAGGAGGTGGACTCAGG - Intronic
1117106103 14:52398406-52398428 CTCAACAAGGAGGTGAACCCTGG + Intergenic
1123038979 14:105482744-105482766 CCCTGGGAGCAGGGGTACCCAGG - Intergenic
1123191392 14:106575598-106575620 CCCTAAGAGGAGGAGAACCTGGG + Intergenic
1132688254 16:1171215-1171237 CCCCACGAGGAGGTGATCCTGGG - Intronic
1140456963 16:75111310-75111332 CCCTAGGAGGAGGTTTGCCCAGG + Intergenic
1149347278 17:55751287-55751309 CCCTGCGGGGAGGTCGACCCCGG - Intronic
1150249590 17:63698568-63698590 GCCCACAAGGAGGTGGACCCCGG - Exonic
1150877598 17:68986711-68986733 CCCTAGGAGGAGGATTCCCCTGG - Intronic
1152918155 17:83052429-83052451 CCCCAGGAGGAGGGGTGCCCGGG + Intergenic
1152918169 17:83052460-83052482 CCCTAGGAGGAGGGGTACCCGGG + Intergenic
1152918188 17:83052511-83052533 CCCCAGGAGGAGGGGTGCCCAGG + Intergenic
1152918247 17:83052664-83052686 CCCCAGGAGGAGGGGTGCCCGGG + Intergenic
1152918267 17:83052715-83052737 CCCCAGGAGGAGGGGTGCCCAGG + Intergenic
1152918289 17:83052766-83052788 CCCCAGGAGGAGGGGTGCCCGGG + Intergenic
1152918309 17:83052817-83052839 CCCCAGGAGGAGGGGTGCCCAGG + Intergenic
1152918330 17:83052868-83052890 CCCCAGGAGGAGGGGTGCCCGGG + Intergenic
1152918351 17:83052919-83052941 CCCCAGGAGGAGGGGTGCCCGGG + Intergenic
1156591908 18:38499677-38499699 CCCTACCAGGAGGAGTTCCCTGG - Intergenic
1157484806 18:48079476-48079498 CCCTCCAATGAGGTGGACCCTGG - Intronic
1160139531 18:76309264-76309286 CCCTATGAGGTACTGTACCCTGG - Intergenic
1160603944 18:80034691-80034713 CCCTAGGGGGCGGTGTCCCCGGG + Intronic
1166937994 19:46346663-46346685 CCCTACGCGGAGCCGGACCCGGG - Intergenic
934777664 2:96949512-96949534 CCCCAGGAGGAGCTGGACCCAGG - Intronic
936869009 2:117110357-117110379 CCCTCCAAGCAGGTGTAGCCAGG + Intergenic
943710846 2:191093275-191093297 CCCTACTGGGAGGTGTCTCCCGG - Intronic
948839979 2:240644132-240644154 TCCTAGGAGGAGGTGTTACCAGG - Intergenic
1170578092 20:17679993-17680015 ACCTACTAGGAGGTCTGCCCCGG + Exonic
1172178178 20:32985148-32985170 CCCAAGGAGGAGGTGTTCCTGGG - Exonic
1182737310 22:32540055-32540077 CCCTAGAAGGAAGTGTTCCCAGG - Intronic
1183306229 22:37084586-37084608 CCCTGGCAGGATGTGTACCCAGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
953407058 3:42664744-42664766 CCCGACGAGGAGGGGTATGCAGG + Exonic
956837900 3:73110702-73110724 CCCCACGAGGAGGCGGCCCCGGG + Intergenic
965615165 3:170585728-170585750 CCCTCCGAGAAGGGGTTCCCTGG - Intronic
968893953 4:3388055-3388077 CCCTCTGAGGAAGTGTATCCTGG + Intronic
974723780 4:65773822-65773844 CCCTACAAGCAGGCGTAGCCAGG + Intergenic
978618507 4:110618561-110618583 CCCTACGACGACATGTACCCAGG - Exonic
979071552 4:116213987-116214009 CCCTAAGAGGAGCTGTAGCAAGG + Intergenic
984609783 4:181825035-181825057 CCCTACTAGAAAGTGTTCCCAGG + Intergenic
984915346 4:184718478-184718500 CCCTACCAGGAGGTGGACGTAGG + Intronic
985012643 4:185600007-185600029 GGCTACGAGGAGGCTTACCCAGG + Intronic
991342229 5:65624262-65624284 CCCTGCGAGGATGGCTACCCTGG - Exonic
992076269 5:73195657-73195679 TCCTGGGAGGAGGTGTACCTGGG - Intergenic
995985269 5:118163597-118163619 CTCTATGAGGAGATTTACCCAGG + Intergenic
997662524 5:135600391-135600413 TCCTTTGAGGGGGTGTACCCTGG + Intergenic
1015274044 6:131366308-131366330 CCCTAAGAGGTGTTGTACCCAGG + Intergenic
1015776866 6:136823088-136823110 CCCTACGGGGACGTGTGCCTGGG - Intronic
1018215662 6:161524861-161524883 CCCAATGAGTAGGTGTACGCAGG + Intronic
1038019517 8:23541228-23541250 ACCTTCAGGGAGGTGTACCCAGG + Intronic
1047192727 8:122692920-122692942 CCCTACAGGCAGATGTACCCAGG + Intergenic
1057550849 9:96050036-96050058 CCCAACCAGGAGGTGTATGCAGG - Intergenic
1061397951 9:130353688-130353710 CCCTAGGAGGTGGTGGAACCCGG + Intronic
1190381062 X:49840188-49840210 CCCTACGTGAAGGTGTAGCTTGG - Intergenic
1192192756 X:69002603-69002625 CCCCACCAGGATGTGTACTCTGG - Intergenic