ID: 1073267737

View in Genome Browser
Species Human (GRCh38)
Location 10:102238348-102238370
Sequence GACTCAGGTTCAGGACGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073267737_1073267747 6 Left 1073267737 10:102238348-102238370 CCCTCCCGTCCTGAACCTGAGTC 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1073267747 10:102238377-102238399 CAATGTTCCCATCCCTGAGCAGG No data
1073267737_1073267748 9 Left 1073267737 10:102238348-102238370 CCCTCCCGTCCTGAACCTGAGTC 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1073267748 10:102238380-102238402 TGTTCCCATCCCTGAGCAGGAGG No data
1073267737_1073267754 26 Left 1073267737 10:102238348-102238370 CCCTCCCGTCCTGAACCTGAGTC 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1073267754 10:102238397-102238419 AGGAGGCAGGCAGAGATATTTGG No data
1073267737_1073267750 13 Left 1073267737 10:102238348-102238370 CCCTCCCGTCCTGAACCTGAGTC 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1073267750 10:102238384-102238406 CCCATCCCTGAGCAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073267737 Original CRISPR GACTCAGGTTCAGGACGGGA GGG (reversed) Intronic
900087208 1:904343-904365 GACGCAGGCTCAGGACGCCAGGG + Intergenic
900526102 1:3129584-3129606 AGCTGAGGGTCAGGACGGGATGG + Intronic
901090630 1:6638429-6638451 GGCTCGGGTCCAGCACGGGAGGG - Intronic
904339846 1:29827671-29827693 GTCTCAGGTTCAGGTCAGGAGGG + Intergenic
905517365 1:38571696-38571718 GACCCAGCTTCAGAACTGGATGG - Intergenic
908552025 1:65218135-65218157 GACTCAGGTGAAGGTCTGGATGG + Intronic
911171741 1:94777088-94777110 TTCTCAGGTTTAGGAGGGGAGGG - Intergenic
912704011 1:111898679-111898701 GACTCAGCTTCAGGAGGGCAAGG - Intronic
919727662 1:200894619-200894641 GAGCCAGGGTCAGGACAGGAGGG + Intronic
924264534 1:242268059-242268081 GGCTCAGGTACAGGATGTGAGGG + Intronic
1064959684 10:20950005-20950027 AACTCAGGTTTAGGAGGGAAAGG - Intronic
1066316705 10:34254646-34254668 GACTCAGGTTGAGGAAGGATGGG - Intronic
1066720274 10:38330425-38330447 GGCTCAGGTACAGGATGTGAGGG - Intergenic
1067792629 10:49299498-49299520 GGCTCAAGTTCATGGCGGGAGGG + Intronic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1071448068 10:85767790-85767812 GATTCTGCATCAGGACGGGATGG - Intronic
1072478493 10:95786428-95786450 GACGCAGGTTCAGTAGGGGAGGG + Intronic
1073267737 10:102238348-102238370 GACTCAGGTTCAGGACGGGAGGG - Intronic
1074532200 10:114305470-114305492 GACGCAGATGCAGGAGGGGACGG + Intronic
1074532248 10:114305662-114305684 GATGCAGGTGCAGGAGGGGACGG + Intronic
1074532326 10:114305911-114305933 GACACAGGTGCAGGAGGGGACGG + Intronic
1074532377 10:114306126-114306148 GATGCAGGTGCAGGAGGGGACGG + Intronic
1076160701 10:128242479-128242501 GACTCAGGTTGTGGCCTGGAGGG - Intergenic
1077093412 11:789535-789557 CACTCAGGTTCAGGGCGGCTGGG - Intronic
1078432428 11:11298235-11298257 GCCACAGCTTCAGGAAGGGAAGG + Intronic
1079096246 11:17512196-17512218 ACCTCAGGTTTAGGACAGGAAGG + Intronic
1079341956 11:19618703-19618725 GAGTCAGGTTGGGGACGTGAGGG + Intronic
1080588179 11:33699929-33699951 GATTAAAGTTCAGGACGGGGTGG + Intronic
1084569758 11:69952139-69952161 GACTCAGGGTCAGGTCAGGCAGG + Intergenic
1090358945 11:126159756-126159778 GGCCCAGGCTCAGCACGGGAAGG - Intergenic
1098987034 12:77023921-77023943 GACCCGTGCTCAGGACGGGATGG + Exonic
1102947711 12:117004617-117004639 GCCTCAGGTTCAGTTCGGGGTGG - Intronic
1103111850 12:118287058-118287080 GACTCGGGGAAAGGACGGGAAGG + Intronic
1104880410 12:132066987-132067009 GGCTCAAGCCCAGGACGGGAGGG - Intronic
1106619918 13:31363171-31363193 GATTGAGGTTCAGGACGTGGGGG - Intergenic
1110519724 13:76461234-76461256 GACTCTGGTGCAGGAGTGGAAGG - Intergenic
1121070640 14:91017534-91017556 GACTCAGGTACAGCACCAGATGG + Intronic
1122288778 14:100668328-100668350 GAATCAGGCTGAGGAAGGGAGGG + Intergenic
1125328467 15:38560593-38560615 GACTCAAGTGCAGGAAGTGAGGG + Intronic
1127121893 15:55779231-55779253 AACTCAGATTCAGGAAGGAATGG + Intergenic
1128799999 15:70491208-70491230 GACTTGGGTTGAGGACAGGAGGG - Intergenic
1129939512 15:79481909-79481931 GACCCAGGTACTGGAGGGGAGGG + Intergenic
1130767346 15:86884310-86884332 GATTCATGTTCAGGCCAGGATGG + Intronic
1132892446 16:2210914-2210936 GGCGCAGGGTCAGGAGGGGAGGG - Exonic
1133107362 16:3521122-3521144 GAGCCAGTTTCAGGAGGGGAAGG - Intronic
1136933048 16:34435956-34435978 GACTCAGGGTGAAGATGGGAGGG + Intergenic
1136971524 16:34975858-34975880 GACTCAGGGTGAAGATGGGAGGG - Intergenic
1139521221 16:67483665-67483687 GGCTCAGGTTCAGGGAGTGAGGG - Exonic
1142263534 16:89053344-89053366 GCCTCAGGCTGAGGACGGGGTGG + Intergenic
1142380730 16:89730477-89730499 GAGGCAGATTCAGGAGGGGAGGG + Intronic
1142928263 17:3259946-3259968 GACTGAGCCTCAGGTCGGGAAGG - Intergenic
1144759355 17:17698595-17698617 GCCTCAGGGTCAGGACAGGAAGG + Intronic
1144956886 17:19023165-19023187 CACTCAGGGTCAGGCAGGGAAGG + Intronic
1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG + Intergenic
1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG + Intronic
1145066881 17:19767278-19767300 AACTGAGGCTCAGGATGGGAAGG + Intergenic
1147110275 17:38256810-38256832 GACTCAGGGCCCGGCCGGGAGGG - Intergenic
1148419235 17:47531621-47531643 GACTCAGGGCCCGGCCGGGAGGG + Intronic
1148913356 17:50955054-50955076 GAAGCAGGTTGAGGAAGGGAAGG - Intergenic
1157763390 18:50281187-50281209 GATTTAGGCTGAGGACGGGAAGG - Intronic
1158518669 18:58151872-58151894 GCTTCAGGGTCAGGACAGGAAGG + Intronic
1168277231 19:55284755-55284777 GACTCAGGTCCTGGAGGAGAGGG + Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
926599219 2:14823964-14823986 GATTCAGGTTCAGGGCAGGTTGG - Intergenic
930628282 2:53723481-53723503 GACTCAGGGAAAGGATGGGAAGG - Intronic
938200430 2:129368145-129368167 GTCTCAGTTACAGGATGGGAAGG - Intergenic
938677449 2:133652924-133652946 GACTGAGGTTCAGAAAGGTAAGG - Intergenic
941702613 2:168620264-168620286 GACTCAGGGAAAGGATGGGAAGG + Intronic
946046142 2:216822628-216822650 GACTGTGGTTCAGGACTGGTAGG + Intergenic
946280857 2:218664510-218664532 GACTCAGGTTCCGCAGGGGCAGG + Exonic
947794019 2:232883160-232883182 GGCGCAGGGTCTGGACGGGAAGG + Intronic
948900803 2:240956076-240956098 AACTGAGGCTCAGGAAGGGAGGG - Intronic
1170661528 20:18345849-18345871 GACTCAGGAGGAGGAAGGGAAGG + Intergenic
1170916524 20:20631879-20631901 GACTGAGGTTCTGGTAGGGAGGG - Intronic
1172175786 20:32971068-32971090 GACAGAGGTTCAGGGAGGGAAGG - Intergenic
1174806486 20:53608268-53608290 GACTCAGGTTCTGTAGGAGACGG - Intronic
1175844717 20:62052407-62052429 GGGTCAGGTTCAGGAGGAGATGG - Intronic
1178370445 21:32022636-32022658 GACTCAGGCTCAGGGCTGCATGG + Intronic
1181631728 22:24155254-24155276 GAAACAGGCTCAGGAGGGGAGGG - Intronic
1185236564 22:49716833-49716855 GACCCAGGGTCAGGAAGGGAGGG + Intergenic
950066500 3:10115962-10115984 GCCTGAGGGTCAGGGCGGGAGGG - Intronic
954755703 3:52838466-52838488 GACTCATGTTCCTGACAGGACGG - Exonic
954774693 3:53006264-53006286 GACTGATGTTCAGGACGGAATGG + Intronic
961394763 3:126578984-126579006 GACTGAGGGTCAGGAGGTGAAGG - Intronic
962403503 3:135081085-135081107 GAATCAGGTGAAGGAGGGGAGGG + Intronic
963123277 3:141794005-141794027 GACTCAGGTGCAGGGAGGGCTGG - Intronic
967940937 3:194766068-194766090 GACTCAGATGCAGGGAGGGAGGG + Intergenic
968920263 4:3518797-3518819 GCCTCAGGTGCAGGAGGGGTGGG + Intronic
969463882 4:7343471-7343493 GCCCCGGGTTCAGCACGGGAAGG + Intronic
969701912 4:8772341-8772363 AACTCAAGCTCAGGAGGGGAGGG + Intergenic
973276028 4:48310274-48310296 GTTTCAGGTTCAGGGCAGGATGG - Intergenic
974754640 4:66187312-66187334 GACTCAGGTTCCAGGCTGGATGG - Intergenic
976324724 4:83758297-83758319 GGGTCAGGCTCAGGAGGGGAGGG + Intergenic
979727054 4:123974758-123974780 GACTGAAGTACAGGAAGGGAAGG - Intergenic
981088013 4:140703560-140703582 AACTCTGGTTCAGGAAGGCAAGG - Intronic
981935753 4:150237946-150237968 CACTCAGGTTCAGGACTGCATGG + Intronic
983097632 4:163583128-163583150 GACTCAGGATCAGAAAGAGAGGG + Intronic
986704112 5:10441448-10441470 AACTCAGGTTCACTACGGGATGG + Intergenic
991411363 5:66348549-66348571 GACTCAGGAGAAGGACGGGGAGG + Intergenic
996621244 5:125506274-125506296 GATTCACGTTCTGGGCGGGATGG - Intergenic
997532303 5:134589258-134589280 GGCACAGAGTCAGGACGGGAGGG + Intergenic
998401236 5:141850129-141850151 AACTCAGGTGCAGGATGGGGTGG - Intergenic
1001967428 5:175921126-175921148 GACCCAGGCTCAGGTAGGGAAGG - Intronic
1002101744 5:176861326-176861348 GAAACAGGTTCAGGATGGGGTGG + Intronic
1002540455 5:179903032-179903054 AACCCAGCTTCAGGAGGGGAAGG - Intronic
1005157136 6:22819683-22819705 GCCTCAGGTTCGGGGAGGGATGG + Intergenic
1006196085 6:32243472-32243494 GGCTGAGGTTTAGGATGGGAGGG + Intergenic
1010794824 6:80106725-80106747 TACTCAGGCTCAGGGCGGCAGGG + Exonic
1012542375 6:100376278-100376300 GACTCAGGCTCAGGGGAGGAGGG - Intergenic
1015462310 6:133505472-133505494 GACTAAGGTTGAAGAAGGGAGGG - Intronic
1015487264 6:133787118-133787140 GCCTCAAGTGCAGGACGGGGAGG - Intergenic
1017951295 6:159137288-159137310 GGGTCAGGTTGAGGACTGGATGG + Intergenic
1019540255 7:1548071-1548093 GACTGAGGTTCAGGGGGGCAGGG + Intronic
1023332288 7:39131193-39131215 CACTCTGGTTCAGGAGGGGAAGG - Intronic
1028513944 7:91655976-91655998 GCCTCAGGTTCAGGCAGAGATGG + Intergenic
1031406776 7:121396109-121396131 GGCTCAGGTTCGGGGAGGGATGG - Intronic
1032586647 7:133153043-133153065 GACACAGGTGCAGTACAGGAAGG - Intergenic
1035442875 7:158918094-158918116 CACTCAGGGTCAGGACGGCCGGG - Intronic
1037864940 8:22436050-22436072 GAGTCAGGGTCAGGCTGGGAAGG + Intergenic
1038393958 8:27233004-27233026 GTCTCAGGTTCAGGTCGGGGTGG - Intergenic
1040336560 8:46418994-46419016 GACTCAGGTTCAGGTTGAGGTGG + Intergenic
1047109748 8:121776348-121776370 GATTCACGTTCAGGGTGGGATGG - Intergenic
1048330174 8:133465799-133465821 GGCTCAGGCTCAGGAAGGCAAGG - Intronic
1049731183 8:144179329-144179351 GCCTCAAGTGCAGGAGGGGAGGG - Intronic
1051126533 9:13811603-13811625 GAGTCAGGGTCAGGGTGGGAGGG - Intergenic
1055961268 9:81822456-81822478 TCCTCAGGTTCAGGGGGGGATGG + Intergenic
1057215179 9:93223993-93224015 GCCCCAGGTGCAGGATGGGAGGG - Intronic
1062228153 9:135465532-135465554 GAATCAGCGACAGGACGGGATGG + Intergenic
1186690787 X:11973489-11973511 GATTCTGGTTCAGTAGGGGAGGG - Intergenic
1193659376 X:84238343-84238365 GACTCAGGGGAAGGATGGGAGGG + Intergenic