ID: 1073267845

View in Genome Browser
Species Human (GRCh38)
Location 10:102239130-102239152
Sequence TTGCCCTCACCAGCAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073267842_1073267845 12 Left 1073267842 10:102239095-102239117 CCTGTCTCACCTTCCAGAGGACT 0: 1
1: 0
2: 1
3: 22
4: 461
Right 1073267845 10:102239130-102239152 TTGCCCTCACCAGCAACCCCTGG No data
1073267840_1073267845 16 Left 1073267840 10:102239091-102239113 CCATCCTGTCTCACCTTCCAGAG 0: 1
1: 0
2: 8
3: 133
4: 1052
Right 1073267845 10:102239130-102239152 TTGCCCTCACCAGCAACCCCTGG No data
1073267844_1073267845 -1 Left 1073267844 10:102239108-102239130 CCAGAGGACTAAACTTTGAAATT 0: 1
1: 0
2: 1
3: 20
4: 262
Right 1073267845 10:102239130-102239152 TTGCCCTCACCAGCAACCCCTGG No data
1073267843_1073267845 3 Left 1073267843 10:102239104-102239126 CCTTCCAGAGGACTAAACTTTGA 0: 1
1: 0
2: 0
3: 16
4: 128
Right 1073267845 10:102239130-102239152 TTGCCCTCACCAGCAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073267845 Original CRISPR TTGCCCTCACCAGCAACCCC TGG Intronic
No off target data available for this crispr