ID: 1073270905

View in Genome Browser
Species Human (GRCh38)
Location 10:102263111-102263133
Sequence TGGGAGCCGGCACTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073270905_1073270915 15 Left 1073270905 10:102263111-102263133 CCCACACACAGTGCCGGCTCCCA 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1073270915 10:102263149-102263171 GTCAGCTGTCCCTGTGGTCCTGG No data
1073270905_1073270911 -7 Left 1073270905 10:102263111-102263133 CCCACACACAGTGCCGGCTCCCA 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1073270911 10:102263127-102263149 GCTCCCAGGAGCAGGTTTATGGG No data
1073270905_1073270910 -8 Left 1073270905 10:102263111-102263133 CCCACACACAGTGCCGGCTCCCA 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1073270910 10:102263126-102263148 GGCTCCCAGGAGCAGGTTTATGG No data
1073270905_1073270914 9 Left 1073270905 10:102263111-102263133 CCCACACACAGTGCCGGCTCCCA 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1073270914 10:102263143-102263165 TTATGGGTCAGCTGTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073270905 Original CRISPR TGGGAGCCGGCACTGTGTGT GGG (reversed) Intronic
900586390 1:3434407-3434429 TGGGAACCCGCACTGTGCCTGGG + Exonic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901379379 1:8862821-8862843 TGGGGGCCTGCACTCAGTGTAGG - Intronic
901716632 1:11160469-11160491 TGGGAGCTTGCATTGTGTCTAGG - Intronic
902564471 1:17301917-17301939 TGGGAGCCCACACTGTTTATTGG - Intergenic
903181158 1:21605657-21605679 TGGGAGCACCTACTGTGTGTCGG - Intronic
903519053 1:23933735-23933757 TGGGATCTGGCACTGTCTCTGGG - Intergenic
906495482 1:46302054-46302076 TGGGAGGCGGGGCTGTGGGTTGG - Intronic
906746623 1:48226427-48226449 TGGGTGCCTGCTCTGTGTTTGGG - Intronic
909145598 1:71926616-71926638 TGGAAGCCGACAATGTGTGGTGG + Intronic
916854455 1:168735759-168735781 TGGGAACCAGGACTGTGTCTTGG + Intergenic
917923645 1:179771226-179771248 GGGGAGCCGGCACTCTGTCTTGG - Intronic
920030608 1:203035332-203035354 AGGGAGCCAGGCCTGTGTGTGGG + Intronic
921741893 1:218694901-218694923 TGGGAGATGGCAGTGTGGGTGGG - Intergenic
922022755 1:221720657-221720679 TGGAAGACTGCTCTGTGTGTAGG + Intronic
922905757 1:229172407-229172429 TTGGAATCTGCACTGTGTGTGGG - Intergenic
923046228 1:230357481-230357503 TGGGAGCCGGCACTGTCAGGTGG - Intronic
924328374 1:242918589-242918611 TTCGATCAGGCACTGTGTGTTGG - Intergenic
1063561579 10:7133288-7133310 TGGGAGGGGGTAGTGTGTGTAGG - Intergenic
1065916573 10:30358445-30358467 TGGGAGAGGCCAGTGTGTGTAGG + Intronic
1066621183 10:37352668-37352690 TGAGGCCCGGCACAGTGTGTGGG - Intronic
1066704192 10:38159788-38159810 TGGGAGCCCACACTGTTTATTGG + Intergenic
1069537404 10:69265160-69265182 TGGGAGCTGGCACGATTTGTGGG + Intronic
1070741362 10:78905404-78905426 TGGGAGCAGGAACTGTAGGTAGG - Intergenic
1071956984 10:90770545-90770567 TGGGAGCAGGCACTGGGAGTGGG - Intronic
1073270905 10:102263111-102263133 TGGGAGCCGGCACTGTGTGTGGG - Intronic
1075103783 10:119524007-119524029 CGGGAGCAGGGACAGTGTGTGGG - Intronic
1077380611 11:2235288-2235310 TGGGAGCAGACACTGGGTGTGGG + Intergenic
1077910145 11:6566195-6566217 TGGGTGCTGGCATTGTGGGTAGG + Intronic
1083774489 11:64887868-64887890 TGGGACCCGCAACTGTGTGTAGG + Intronic
1084876432 11:72137021-72137043 TGTCAGCCGGCACTGGGCGTGGG + Intronic
1085255651 11:75171217-75171239 GGGGAACCAGCTCTGTGTGTGGG + Intronic
1087664103 11:101022867-101022889 TGGGAGAAGGCGCTTTGTGTGGG - Intergenic
1089349861 11:117816180-117816202 TGGGAGGGGGCACTGAGTCTGGG + Intronic
1090981305 11:131724909-131724931 TTGGAGCTTGGACTGTGTGTTGG + Intronic
1091817020 12:3446374-3446396 TGTGAGCCGGCTCTCTCTGTGGG + Intronic
1093638955 12:21503011-21503033 TGGGGGGTGGCAGTGTGTGTAGG - Intronic
1097916031 12:65021388-65021410 TGGGCTCCAGCACTGTGTGCTGG + Intergenic
1099191889 12:79569680-79569702 TGGCAGACTGCACTGTGTGCTGG + Intergenic
1103926028 12:124423695-124423717 TGGGAGCCCCCACTGTGCCTGGG - Intronic
1104809283 12:131610855-131610877 CTGGAGCTGGAACTGTGTGTAGG - Intergenic
1104823870 12:131694627-131694649 AGGGAGCAGGCACTCTTTGTAGG - Intergenic
1104955788 12:132465268-132465290 AGGAAGCAGGCTCTGTGTGTAGG + Intergenic
1105326957 13:19379404-19379426 TGGTAGCAGGCGCTGGGTGTAGG - Intergenic
1105672638 13:22636760-22636782 TGGCAGCCGGCAGCTTGTGTTGG - Intergenic
1106568112 13:30904639-30904661 TGGGAGCCTCCCCTGTGTATTGG + Intergenic
1107828534 13:44352881-44352903 AGGGTGCTGGCAGTGTGTGTGGG - Intergenic
1108098720 13:46932560-46932582 TGGGAGCCCACACTGTTTATTGG + Intergenic
1112140480 13:96635811-96635833 TGGGAGCCCACACTGGATGTGGG + Intronic
1113068395 13:106394219-106394241 TGGGAGTTGGTGCTGTGTGTAGG - Intergenic
1113765656 13:112879642-112879664 TGGACGCCGGCCCTGTCTGTGGG - Intronic
1117251379 14:53942866-53942888 TGAGGGCCTACACTGTGTGTAGG - Intergenic
1121262078 14:92573747-92573769 TGGGAACCAGCAGTGTGTGAGGG - Intronic
1122205200 14:100144849-100144871 AGGGAGCCGGCACTGCCTGCTGG + Exonic
1123944739 15:25233558-25233580 TGTGGCCCGGCTCTGTGTGTCGG + Intergenic
1123948071 15:25248502-25248524 TGGGACCTGGCTCTGTGTGTGGG + Intergenic
1124246981 15:28079538-28079560 CGAGAGCCCGCACTGTGGGTGGG + Intronic
1124617393 15:31251489-31251511 TGGGAGCCAGCTCTGGGTCTAGG - Intergenic
1127368454 15:58312933-58312955 GGGGAACAGGCACTGTGTGATGG + Intronic
1129210417 15:74064904-74064926 TGGGAGAGGCCAGTGTGTGTGGG + Intergenic
1129403597 15:75300469-75300491 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1129682634 15:77666455-77666477 CGTGAGCCGGCACTGGGTGAGGG + Intronic
1129868145 15:78924372-78924394 TGGAAGCTGGAACAGTGTGTGGG + Intronic
1130485467 15:84396031-84396053 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1132585557 16:704637-704659 TGGGAGACGGCCCTGTGTCCAGG + Intronic
1132660330 16:1058193-1058215 TGGGAGCCGGGACTCCGGGTGGG - Intergenic
1133368750 16:5232035-5232057 TGGGTGCCTACACTGTGTGGGGG - Intergenic
1134799241 16:17069393-17069415 TGGGAACCAGCACTGGGTATGGG + Intergenic
1135182736 16:20289796-20289818 CTGGAGCCAGCACAGTGTGTGGG - Intergenic
1135913066 16:26578792-26578814 TGGGGACAGGCTCTGTGTGTTGG + Intergenic
1136143150 16:28299931-28299953 TGGCAGAGGGCACTGTGTGGAGG - Intronic
1137720421 16:50624590-50624612 TGGGAGCAGGCAGTGTGTAGGGG + Intronic
1141518455 16:84561996-84562018 TGGGAGCCAGCACAGTGTGAGGG - Intergenic
1141889996 16:86920001-86920023 TGGGAGCCTGGAGTGGGTGTCGG - Intergenic
1142129567 16:88426572-88426594 TGGGAGCCGGCACCGTCTGGAGG + Intergenic
1142228173 16:88887468-88887490 TGGGAGCCGGGGCGGTGGGTGGG + Intronic
1145304428 17:21665499-21665521 AGGGAGTGGGCACTGTGTGGTGG - Intergenic
1146338014 17:31991944-31991966 TGTGAGCAGGCACTAAGTGTTGG - Intronic
1146909346 17:36638587-36638609 TGGGAGCCGGCATGGAGTGGAGG - Intergenic
1147585481 17:41651798-41651820 TGGGAGCTGGCACTGGGAGCTGG - Intergenic
1149430702 17:56594046-56594068 TGGGAGCCGGCGCTGCGCGAAGG + Exonic
1150283363 17:63942032-63942054 GGGGGGCCGGCACAGGGTGTGGG + Intronic
1151308984 17:73282036-73282058 TGGGAGGTTGCACTGTGTCTGGG + Intergenic
1152123862 17:78434879-78434901 TGGGGCCAGGCACTCTGTGTGGG + Intronic
1152772123 17:82176559-82176581 TGGGAGCCCACACTGTTTATTGG - Intronic
1152857837 17:82676266-82676288 GGGGTGCCCTCACTGTGTGTGGG - Intronic
1153945323 18:10012716-10012738 TGGGAGCCAAAAGTGTGTGTAGG - Intergenic
1154070379 18:11147898-11147920 TGGGAGGCGGGACTAGGTGTTGG + Intronic
1155053263 18:22165804-22165826 CGGGAGCCGGCGCTGGGGGTGGG + Intergenic
1155233149 18:23793776-23793798 TGGGATCTGGCACTGTCTTTAGG - Intronic
1156233452 18:35178355-35178377 TGGGAGCTGGCACTATCTGAAGG + Intergenic
1160019522 18:75169639-75169661 AGGGAGCCTTCATTGTGTGTTGG + Intergenic
1160420141 18:78738387-78738409 TGTGTGCGGGGACTGTGTGTGGG - Intergenic
1160946429 19:1646046-1646068 TTGGAGCTGGGCCTGTGTGTGGG - Intronic
1161045244 19:2131025-2131047 GAGGAGCCGGCACTCTGTGAAGG + Intronic
1161331835 19:3692303-3692325 TGGGAGCCGGCAGTGGGACTGGG - Intronic
1161352544 19:3801937-3801959 TGGGAACGGGAACTGTGGGTGGG + Intronic
1161973068 19:7594371-7594393 TGGGAGAAGGCTCTGTGTGGAGG - Intergenic
1162022997 19:7876458-7876480 TGGAAGGAGGCACTGGGTGTGGG - Intergenic
1162291779 19:9785845-9785867 TGGGAGCGGGGACTGGGTGAAGG - Intronic
1164826290 19:31287152-31287174 TGGGAGGGGGCACTGGGTGTGGG + Intronic
1164868107 19:31621774-31621796 TGTGAGCCAGCAATGTGTGCTGG + Intergenic
1167507991 19:49881243-49881265 AGGGAGACGGCACTGTGTTGGGG - Intronic
1167753773 19:51397477-51397499 TGGAAGCCCGCACTGTTTATTGG + Intergenic
1167997103 19:53414543-53414565 TGGGAGCCCGCAGTTTGTGGAGG - Intronic
1168006868 19:53497200-53497222 TGGGAGCCCGCAGTTTGTGGAGG - Intergenic
1168125992 19:54283181-54283203 TGGGATCCGGGACTGTCTCTGGG + Intergenic
1168171285 19:54591606-54591628 TGGGATCTGGGACTGTGTCTGGG - Intronic
1168476355 19:56678261-56678283 TGTGGGTCGGCACTGTGGGTTGG + Intergenic
927515495 2:23669552-23669574 AGGGAGCCCCCACTGTGTGCCGG - Intronic
927523009 2:23712472-23712494 TGTGAGCCTGCATTGTGTGATGG + Intergenic
929080239 2:38115360-38115382 TGGGAGCCGGCAGTGACTGATGG - Intergenic
934789812 2:97049677-97049699 TGGGACCCTGCACAGTGTGATGG + Intergenic
934816657 2:97332862-97332884 TGGGACCCTGCACAGTGTGATGG - Intergenic
934821039 2:97375622-97375644 TGGGACCCTGCACAGTGTGATGG + Intergenic
935427247 2:102932917-102932939 TAGGAGCCGGCATTGTATCTTGG - Intergenic
937139907 2:119590927-119590949 TGGGGGCCTGCGCTGTGTGCTGG - Intronic
937303058 2:120854998-120855020 GGGGAGCCTGCTCTGTGTGGAGG - Intronic
1169263653 20:4154930-4154952 TGGGAGCTGGGGCTGTGTGAGGG + Intronic
1171521945 20:25782931-25782953 AGGGAGTGGGCACTGTGTGGTGG - Intronic
1171554880 20:26072952-26072974 AGGGAGTGGGCACTGTGTGGTGG + Intergenic
1173527477 20:43744149-43744171 TGGGATCCTGCACAGTGTGAGGG + Intergenic
1174955620 20:55094712-55094734 GGAGAGCCGGCCATGTGTGTGGG + Intergenic
1175678383 20:60966506-60966528 TGGGAGCCGAGACTCTCTGTGGG - Intergenic
1175992800 20:62797771-62797793 TTGGAGCTGGCACTGTGTGACGG + Intronic
1176102321 20:63370188-63370210 TGGGAGGAGGCACTGCGTGGAGG - Intronic
1176655755 21:9587926-9587948 AGGGAGTGGGCACTGTGTGGTGG - Intergenic
1179470134 21:41604945-41604967 TGGGAGCCGGCACTGGGCACTGG - Intergenic
1179727294 21:43347632-43347654 TGGGGGCCGGCACTGTGGACGGG - Intergenic
1181465045 22:23106449-23106471 TGGGCCCTGGCACTGTGGGTGGG + Intronic
1181621472 22:24094396-24094418 TTGGAGCCAGCACTGTGTGCTGG - Intronic
1182554773 22:31123179-31123201 AGGGAGCCTGCAGTGTATGTGGG - Intronic
1182712283 22:32330472-32330494 TTGGAGGCTCCACTGTGTGTTGG + Intergenic
1183075372 22:35423365-35423387 TGTGAGCCGGCACGGGGTGCAGG + Intronic
949695440 3:6688894-6688916 TGGGAACCGTCACTATGTGGTGG - Intergenic
954682090 3:52351355-52351377 TGTGAGGCAGCACTGGGTGTGGG - Intronic
955073473 3:55591333-55591355 TGGGACCCAGCACTGTGACTGGG + Intronic
960855095 3:122094589-122094611 TGGAAGCCGGCCCTGTGGCTAGG - Intronic
962737919 3:138342254-138342276 TGGGAGTTGGCTCTGTGTTTGGG + Intergenic
966791382 3:183673585-183673607 TGGGAGGTGGCAGTGTGGGTAGG - Intronic
966887913 3:184386892-184386914 CGGGAGCCTGCACCGGGTGTGGG - Exonic
968752068 4:2395484-2395506 TGGGAGCTGGAACAGTGTGAGGG + Intronic
968917080 4:3501277-3501299 TGGGAGCGGGCACTGGGTCCTGG - Intronic
969482582 4:7454598-7454620 TGGGGTCAGGCACTGTGTGTTGG + Intronic
969482691 4:7455139-7455161 TGCGGTCAGGCACTGTGTGTTGG + Intronic
969482716 4:7455251-7455273 TGGGGTCAGGCACTGTGTGTTGG + Intronic
969634316 4:8357718-8357740 TAGGAGCAGGGACCGTGTGTGGG + Intergenic
971828668 4:31661772-31661794 TGGGGACCTGCACTGTGTATAGG + Intergenic
971925746 4:33007334-33007356 AGGGAACCAACACTGTGTGTAGG - Intergenic
977700317 4:100014611-100014633 TGTGAGCCCTCACTGTGTGCAGG + Intergenic
978624003 4:110664106-110664128 TGGGGGCTGGGGCTGTGTGTTGG + Intergenic
978785134 4:112600867-112600889 TGGGAGCCCACACTGTTTATTGG - Intronic
987118383 5:14744537-14744559 TGGGAGCAGGCTGTGTGTGGAGG + Intronic
988007718 5:25439171-25439193 TGGGAAGCTGCCCTGTGTGTGGG + Intergenic
993485849 5:88484204-88484226 TGGAGGCCGGCAGTGTGTGGAGG - Intergenic
994477536 5:100290173-100290195 TGAGACCCAGCACTGTGTGCTGG - Intergenic
994754640 5:103779121-103779143 TGGGAGCCGGGGCTGCGTGCGGG - Intergenic
994916134 5:105982511-105982533 TCGGAGCAGGCACTGAGAGTAGG - Intergenic
995543395 5:113205999-113206021 TGGCAGCAAGCACTGTGTGCTGG + Intronic
998148386 5:139743397-139743419 TGGGAGCCTGCAGTGTGTGGAGG + Intergenic
999715743 5:154358601-154358623 TGGGAGGTAGCACAGTGTGTGGG - Intronic
1001845577 5:174918081-174918103 TGGGAGACGCCAGGGTGTGTGGG + Intergenic
1002642729 5:180638114-180638136 CGGTGGCCAGCACTGTGTGTTGG - Intronic
1007377512 6:41466917-41466939 AGGGAGCCGGCTCCCTGTGTAGG - Intergenic
1007834755 6:44665903-44665925 TCGGGGACGGCTCTGTGTGTGGG + Intergenic
1010569636 6:77462423-77462445 TGGGAGCCTTTATTGTGTGTTGG - Exonic
1012915415 6:105165157-105165179 TGAGAGCTGGCACTGAATGTTGG - Intronic
1015562914 6:134535895-134535917 TGTGAGCCCCCACTGTGTCTGGG + Intergenic
1016709738 6:147156178-147156200 TGGGAGCAGTCTCTGAGTGTGGG - Intergenic
1019550698 7:1601033-1601055 GGGGAGCAGGCTCTGTTTGTGGG + Intergenic
1019641516 7:2106120-2106142 TGGGAGGCGGGACTGTGTGCTGG - Intronic
1019843476 7:3473736-3473758 TGGGAGCCAGGGCTCTGTGTAGG - Intronic
1022199669 7:28104048-28104070 TGGGAGCCTGCCCGGTGTGCTGG - Intronic
1024524304 7:50335830-50335852 TGGGAGCAGGCCATGTGGGTAGG + Intronic
1024605661 7:51020639-51020661 TGGAAGCAAGCACTGAGTGTGGG + Intronic
1025282447 7:57638113-57638135 AGGGAGTGGGCACTGTGTGGTGG - Intergenic
1025302283 7:57827406-57827428 AGGGAGTGGGCACTGTGTGGTGG + Intergenic
1026845670 7:73697708-73697730 TGGGAGCTGGCAGGGTGGGTGGG + Intronic
1026955530 7:74374045-74374067 TGGGACCCAGCACTCTGTGCAGG + Intronic
1027766387 7:82348438-82348460 TGGCAGCCTGCACAGTGTCTGGG + Intronic
1029532909 7:101137247-101137269 GGGGACCCGGCACTGTCTGTGGG - Intronic
1037818678 8:22125221-22125243 TAGGAGCTGGCAGTGTGGGTGGG + Intronic
1042695830 8:71554506-71554528 TGGGAGCTGGTACTGTGTGCAGG + Intronic
1044409461 8:91867853-91867875 TTGGAGCAGGCACTGAGAGTGGG - Intergenic
1049091736 8:140519905-140519927 TGGGAGCAGCCATGGTGTGTCGG - Intergenic
1049301180 8:141871679-141871701 TGGTGGTTGGCACTGTGTGTAGG + Intergenic
1049301226 8:141871853-141871875 TGGTGGTTGGCACTGTGTGTAGG + Intergenic
1049301309 8:141872174-141872196 TGGTGGTTGGCACTGTGTGTAGG + Intergenic
1049301355 8:141872351-141872373 TGGTGGTTGGCACTGTGTGTAGG + Intergenic
1049301362 8:141872383-141872405 TGGTCGTGGGCACTGTGTGTAGG + Intergenic
1049301422 8:141872634-141872656 TGGTGGTTGGCACTGTGTGTAGG + Intergenic
1049301464 8:141872801-141872823 TGGTGGTGGGCACTGTGTGTAGG + Intergenic
1049557408 8:143289821-143289843 AAGGAGCCGGGACTGTGTCTAGG + Intronic
1055329177 9:75164158-75164180 TGGGAGCCCACACTGTTTATTGG - Intergenic
1056270988 9:84947949-84947971 TGTGAGCCGGCAGTGTTTGTGGG + Intronic
1058598594 9:106644539-106644561 TGAGAGACAGCACTGTGTTTAGG - Intergenic
1061185385 9:129049859-129049881 TGGGAGCAGGCACTAAGCGTGGG + Exonic
1061416831 9:130451603-130451625 TGGGCGGCGGCACTGCGTGCTGG + Exonic
1062331728 9:136047900-136047922 TGGGAGCCAGGGCTGGGTGTCGG - Intronic
1203633472 Un_KI270750v1:91387-91409 AGGGAGTGGGCACTGTGTGGTGG - Intergenic
1189647028 X:43144263-43144285 TGTGAGCCTGCTTTGTGTGTGGG + Intergenic
1190181833 X:48198818-48198840 TGGGGGCTGACACTCTGTGTCGG + Intronic
1192312725 X:70029869-70029891 TGAGAGCCGGCAAGGTGTCTGGG - Intronic
1196487038 X:116224022-116224044 TGGCAGCAGAAACTGTGTGTGGG - Intergenic
1200067310 X:153510008-153510030 TGGCAGGTGACACTGTGTGTAGG + Intergenic
1200142064 X:153907353-153907375 TGGGAGCCAGCTCTCTGTCTCGG - Intronic
1201225757 Y:11817546-11817568 TTCGATCAGGCACTGTGTGTTGG - Intergenic
1201948749 Y:19540494-19540516 TGCGGGCCAGCACTGGGTGTGGG - Intergenic
1202085856 Y:21135929-21135951 TGGAAGGGGGCACTTTGTGTGGG + Intergenic
1202604855 Y:26630194-26630216 TGGTAGCAGGCACTGGGTGTAGG + Intergenic