ID: 1073271128

View in Genome Browser
Species Human (GRCh38)
Location 10:102265029-102265051
Sequence CTGTGGCATGGGATGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073271122_1073271128 -9 Left 1073271122 10:102265015-102265037 CCTTGTGGTAGGATCTGTGGCAT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073271128 Original CRISPR CTGTGGCATGGGATGGGGCA TGG Intronic
No off target data available for this crispr