ID: 1073271230

View in Genome Browser
Species Human (GRCh38)
Location 10:102265935-102265957
Sequence CAGTGTAAGACTAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073271221_1073271230 14 Left 1073271221 10:102265898-102265920 CCTAATGTCCAGTTTTGGTTATC 0: 1
1: 0
2: 2
3: 12
4: 142
Right 1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG No data
1073271223_1073271230 6 Left 1073271223 10:102265906-102265928 CCAGTTTTGGTTATCAGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073271230 Original CRISPR CAGTGTAAGACTAAGGTGGA GGG Intronic
No off target data available for this crispr