ID: 1073274386

View in Genome Browser
Species Human (GRCh38)
Location 10:102296747-102296769
Sequence AAAAAAAAGAATTGTAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073274384_1073274386 11 Left 1073274384 10:102296713-102296735 CCTAGGCGACAGAGTGAGACTCT 0: 226
1: 7013
2: 45993
3: 128884
4: 177784
Right 1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG No data
1073274383_1073274386 15 Left 1073274383 10:102296709-102296731 CCAGCCTAGGCGACAGAGTGAGA 0: 613
1: 20079
2: 110731
3: 179866
4: 201579
Right 1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG No data
1073274382_1073274386 25 Left 1073274382 10:102296699-102296721 CCACTGCACTCCAGCCTAGGCGA 0: 2004
1: 73472
2: 229406
3: 247347
4: 150976
Right 1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073274386 Original CRISPR AAAAAAAAGAATTGTAGGCC AGG Intronic
No off target data available for this crispr