ID: 1073276090

View in Genome Browser
Species Human (GRCh38)
Location 10:102312735-102312757
Sequence CACCAGGAGCAGTGTCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073276090_1073276096 8 Left 1073276090 10:102312735-102312757 CCCATGAGACACTGCTCCTGGTG 0: 1
1: 1
2: 2
3: 12
4: 158
Right 1073276096 10:102312766-102312788 GGGTACCTGTAAAGTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073276090 Original CRISPR CACCAGGAGCAGTGTCTCAT GGG (reversed) Intronic
900407522 1:2499049-2499071 CGCCAGGAGGAGTGTCCCATGGG - Intronic
906366575 1:45215213-45215235 CACCAGGAGCTATTTCTCTTAGG + Intronic
911090847 1:94015744-94015766 CAGCAGGAGCAGTGCCACAAGGG + Exonic
911141946 1:94512957-94512979 CAGCAGCAGCAGTGTCACCTAGG + Intronic
917051743 1:170932254-170932276 CACAAGAAGCAGTGTCCCAAGGG + Intergenic
917760464 1:178151649-178151671 CACCAGGAGCCTTGGATCATTGG - Intronic
922443913 1:225680098-225680120 TACCAGCAGCAGTTTATCATAGG - Intergenic
922809021 1:228405898-228405920 CCCCGAGAGCAGGGTCTCATTGG + Intronic
1063261383 10:4393076-4393098 AACCAGCAGAAGTGCCTCATTGG + Intergenic
1064369290 10:14737340-14737362 GGCCAGGTGCAGTGACTCATGGG + Intronic
1065126748 10:22581157-22581179 CACCAGGAGGAATGCCTCAGGGG - Intronic
1067323979 10:45248994-45249016 GAGCAGGAGCAGCATCTCATTGG - Intergenic
1067809448 10:49416044-49416066 CACCAGGAGTGGTGTCTGGTAGG + Intergenic
1070744911 10:78927794-78927816 CACCAGGTGCACGGTCACATGGG + Intergenic
1071006740 10:80892039-80892061 CACCAGGAGGTGAGACTCATTGG - Intergenic
1071363952 10:84879604-84879626 ACCCAGGAGCAGTTTCTCAGAGG - Intergenic
1071565509 10:86669572-86669594 CTCCAGGAGCAGGGACTGATGGG + Intronic
1071964944 10:90843014-90843036 CACCAAGAGGAATGTCTTATAGG + Intronic
1072069110 10:91899542-91899564 CACCAAGAGCATAGTCTCTTTGG + Intergenic
1073276090 10:102312735-102312757 CACCAGGAGCAGTGTCTCATGGG - Intronic
1073607417 10:104910236-104910258 ACCAAGGAGCAGTGTCTCTTTGG + Intronic
1074156342 10:110803527-110803549 CACCAGCAGCAGCATCTCCTGGG - Intronic
1074800971 10:117000812-117000834 TTCCAGGAGGAGTGTCTGATTGG - Intronic
1074859000 10:117496131-117496153 CAGAAGGTGCAGGGTCTCATGGG - Intergenic
1076349537 10:129806506-129806528 CCCATGGAGCACTGTCTCATAGG - Intergenic
1077100765 11:821371-821393 CACCAGGCCCAGTGACTCATAGG + Intronic
1079760684 11:24325816-24325838 CAACAGGAATAGAGTCTCATAGG - Intergenic
1083864994 11:65448867-65448889 CACCAGGAGCAGTCTGGCAACGG - Intergenic
1088746520 11:112808944-112808966 CATCAGGACCAGTGTCACATAGG - Intergenic
1089017913 11:115182069-115182091 GACCAGGATCTGTGGCTCATGGG - Intronic
1089191864 11:116659499-116659521 GACCAGGAGAAATGTCTCCTGGG - Intergenic
1091858248 12:3756137-3756159 CACCAGGAAATGTGTGTCATTGG + Intronic
1094489751 12:30952277-30952299 GACCAGGTGCAGCGTCTCCTGGG - Intronic
1096011948 12:48225361-48225383 CACCAGGAGCAGCATCACCTGGG + Intergenic
1098971097 12:76857787-76857809 CCCCAGGAGCAGGGTGTAATAGG - Intergenic
1100040901 12:90315359-90315381 GACCAGGTGCAATGGCTCATTGG - Intergenic
1100361527 12:93884107-93884129 TACCAGGAGCAGAGGCTCACTGG + Intronic
1102217774 12:111173851-111173873 CAGCAGGATCAGTGTCACCTGGG - Intronic
1105346942 13:19581949-19581971 TACCAGTAGCAGTGGCTCACTGG + Intergenic
1108356326 13:49631582-49631604 GGCCAGGTGCAGTGGCTCATGGG + Exonic
1109476569 13:62887039-62887061 CAGCAGTGGCAGTTTCTCATTGG + Intergenic
1113883110 13:113639813-113639835 CATCAGGAGCAGTGCCCCAGAGG - Intronic
1114448860 14:22811255-22811277 CACCAGGTGCAATTGCTCATTGG - Intronic
1114614388 14:24060545-24060567 CACCAGTAGCACTGTCTAAGGGG + Intronic
1115376515 14:32682846-32682868 CACCAGCAGCAGTATCTCCTAGG + Intronic
1117216750 14:53559469-53559491 CACCAGAAGCAGTTTCCCTTTGG + Intergenic
1118018487 14:61685997-61686019 GGCCAGGAGCAGTGGCTCAGTGG + Intergenic
1119442529 14:74637852-74637874 AAGCAGGAGCAGAGTCTCAGAGG - Intergenic
1121624516 14:95374493-95374515 CATCAGGAGCTGTGTGTCAGGGG + Intergenic
1122178497 14:99938035-99938057 CGGCAGGAGGTGTGTCTCATGGG - Intronic
1122804459 14:104249654-104249676 CACCAGGGGGAGGGTCTCATGGG - Intergenic
1123056813 14:105574720-105574742 CACCAGCAGCAGCTCCTCATGGG + Intergenic
1123081397 14:105697065-105697087 CACCAGCAGCAGCTCCTCATGGG - Intergenic
1124413481 15:29455815-29455837 CAGCAGCAGCAGATTCTCATAGG + Intronic
1132986605 16:2770695-2770717 CTGGAGGAGCGGTGTCTCATGGG - Exonic
1133391086 16:5410722-5410744 CAGCTGGAGCAGTGGCTCAGAGG - Intergenic
1133667369 16:7982066-7982088 TACCAGGAGGTGTGCCTCATTGG + Intergenic
1134433421 16:14233506-14233528 GACCAGGCACAGTGGCTCATGGG + Intronic
1135206931 16:20492222-20492244 CACCAGGGGCAGTGTCCCTGGGG + Intergenic
1135211954 16:20531410-20531432 CACCAGGGGCAGTGTCCCTGGGG - Intergenic
1137574092 16:49586969-49586991 CACCAGGCACAATGTCTCGTTGG + Intronic
1137821606 16:51450965-51450987 CCCCACTAGCAATGTCTCATTGG + Intergenic
1137844621 16:51674868-51674890 CATCAGGAGCAAAGTCTCCTGGG + Intergenic
1143688681 17:8541127-8541149 CAGGAGGAGCAGTGGCACATCGG - Intronic
1145028488 17:19486998-19487020 CTCCAGAAGCAGTGTCTGAGAGG + Intergenic
1146567446 17:33925390-33925412 CACCAGAAGCAGGGACTCAATGG - Intronic
1146652897 17:34617340-34617362 CACATGGAGCAGTGTCCCAAAGG - Intronic
1151429960 17:74055736-74055758 CATCAGCATCAGTGTCTCCTGGG - Intergenic
1152143052 17:78549832-78549854 CAGCAGGTGCAGGGTCTCAGAGG - Intronic
1152879137 17:82805445-82805467 CACCAGGTGCTGCGTCTCACCGG - Intronic
1153838054 18:8981940-8981962 CCCCAGGAGAGGTTTCTCATGGG - Intergenic
1156702994 18:39846915-39846937 CAACAGCATCAGTGTCTCCTGGG + Intergenic
1156748204 18:40418228-40418250 CACCAGGAGTAGTGTTTCAGAGG - Intergenic
1160015670 18:75138506-75138528 CACCAGGAGCAGGGCCTCATGGG - Intergenic
1163076365 19:14895604-14895626 CACGCAGAGCAATGTCTCATAGG - Intergenic
1167667993 19:50833778-50833800 CACCAGGAGCAGTTCCTCAAGGG + Intronic
1167907438 19:52673752-52673774 GGCCAGGAGCAGTGGCTCTTTGG + Intronic
1168341299 19:55624481-55624503 CACCAGGTCCAGTGGCTCCTGGG + Exonic
924977838 2:194067-194089 CAGCAGGAGCAGTGTCTTCCCGG + Intergenic
925218094 2:2114726-2114748 CACCTGTAGCATTGACTCATTGG - Intronic
927488731 2:23506464-23506486 CTACAGGAGCAGTGGCTCTTGGG - Intronic
937692541 2:124772288-124772310 CACCTGCAGCAGTGTCTCCTTGG + Intronic
938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG + Intronic
940099547 2:150018386-150018408 CACCAGGAGCAATGACTCCAGGG - Intergenic
945922579 2:215770754-215770776 CACCAGCAGCAGTGGCTCATGGG - Intergenic
947824850 2:233098704-233098726 CACCAGGTTGAGTGTGTCATGGG - Intronic
1169804728 20:9547762-9547784 CAGCAGCAGCAGTGTCACCTGGG + Intronic
1170779517 20:19411655-19411677 CACTTGGAGGAGGGTCTCATTGG + Intronic
1172385075 20:34528410-34528432 TATCAGCAGCAGTGTCTCAGTGG - Intronic
1172652166 20:36511481-36511503 GGCCAGGTGCAGTGGCTCATGGG - Intronic
1172945936 20:38689223-38689245 GAACAGGAGCAGTGTGGCATGGG + Intergenic
1173476246 20:43361846-43361868 CAGCAGCAGCAGTGTCACCTGGG - Intergenic
1173917701 20:46721230-46721252 CACCAGGAGGCATGACTCATTGG + Intronic
1175097546 20:56553391-56553413 CACCAGGAGGAGGGGCTCCTGGG + Intergenic
1177858328 21:26424448-26424470 CACCAGGAGCTGTGACCCTTAGG + Intergenic
1178603289 21:34013500-34013522 CAGCAGCAGCAGTGTCACCTGGG + Intergenic
1178888921 21:36504857-36504879 CTCTGGGAGCAGTGACTCATGGG - Intronic
1181897704 22:26125447-26125469 CAAGAGGAGCAGCCTCTCATGGG + Intergenic
1182122727 22:27797885-27797907 CCCCAGGAGCAGTCCCTCCTGGG + Exonic
1183357048 22:37365118-37365140 CCCCAGGCCCAGTGTCTCAGAGG - Intergenic
1184261058 22:43316617-43316639 CACCAGGAGCTGAGCCTCAGGGG + Intronic
1184412682 22:44333893-44333915 CGCCAGGAGAAGTATCTCATGGG - Intergenic
1184595519 22:45511726-45511748 GGCCGGGAGCAGTGGCTCATGGG - Intronic
1184679458 22:46062184-46062206 CCCCGGGAGCAGTGTCTCTGCGG - Intronic
1185174173 22:49310535-49310557 CAGCAGGAGCAGAGTCTCCCTGG + Intergenic
953844025 3:46412649-46412671 CACAGGGAGCACAGTCTCATCGG + Intronic
953974540 3:47372005-47372027 CACCAGGAGCTGTGTCAGAAAGG - Intergenic
955189498 3:56747300-56747322 CACAGGGAGCAGTGGCCCATTGG - Intronic
957979458 3:87489934-87489956 TGCAAGGAACAGTGTCTCATTGG + Intergenic
959593975 3:108108658-108108680 CACCAGGCCTATTGTCTCATAGG - Intergenic
961661594 3:128471594-128471616 CACCAGGCTCAGTGGCTCAGTGG + Intergenic
962264818 3:133937345-133937367 CAGCAGGAGCAGGGTCTGAAGGG + Intronic
964494340 3:157272171-157272193 CAGCAGGAGCATTGTCTTAGTGG + Intronic
964546112 3:157835453-157835475 CACTAGGGCCAGTGGCTCATAGG - Intergenic
964995544 3:162874647-162874669 CAACAGGATCAGATTCTCATAGG + Intergenic
966736071 3:183188157-183188179 CACCAGTAGAAGTGCCTGATGGG + Intronic
972336783 4:38114093-38114115 CACCAGAAGCAGGGGCTCCTGGG - Intronic
975136837 4:70883460-70883482 AACCAGGTGCAGTGGCTCAATGG + Intergenic
976281948 4:83334627-83334649 CACCAGGTGCAGCGGCTCCTGGG + Exonic
978493153 4:109330626-109330648 CACCTTGAGCAGTTTCTCAAAGG + Intergenic
980745777 4:137013159-137013181 CACAAGGTGCTGTGTCTCTTTGG - Intergenic
982082175 4:151801055-151801077 CACCAGGAGGGGTGTTTCACTGG + Intergenic
995395150 5:111679631-111679653 CACCAAAAGGAGTGTCACATAGG - Intronic
998477709 5:142435532-142435554 CACCAGGGGGTGTGTCTGATTGG + Intergenic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1000803423 5:165757850-165757872 CCCCAGGAGCCGTTTCACATGGG - Intergenic
1000974915 5:167754173-167754195 CACAAGGTGCAGTATCTTATAGG - Intronic
1002765084 6:232517-232539 CATCAGCATCAGAGTCTCATAGG - Intergenic
1005081051 6:21956883-21956905 CACCAGGAACACTGCCTCATTGG + Intergenic
1005856863 6:29869415-29869437 CACCCTCGGCAGTGTCTCATGGG + Intergenic
1006080205 6:31560667-31560689 CACCAGGAGTTGAGTCTCAGTGG + Intergenic
1008770240 6:54970180-54970202 CACTGGGAGTAGTGTGTCATTGG - Intergenic
1012872603 6:104689828-104689850 CACTAAGATCAGTGTCACATGGG + Intergenic
1013188703 6:107783860-107783882 GACCAGGAGCAGTTTCTAGTAGG - Intronic
1015452939 6:133391571-133391593 AATCAGGAGCAGTGTCACATGGG - Intronic
1022007523 7:26279763-26279785 TACCTGGAGCAGTGACTCAAGGG - Intergenic
1024275824 7:47676195-47676217 GGCCAGGTGCAGTGGCTCATTGG - Intergenic
1024909226 7:54426389-54426411 AACCAGGATCAGTGCCTCAGAGG + Intergenic
1027363893 7:77436674-77436696 CACCAGGCACAGTGTGTCAGTGG + Intergenic
1027468283 7:78541612-78541634 CAACAGCAGCAGTGTCACCTGGG + Intronic
1028879597 7:95865090-95865112 CACCAGCAGCAGTGCCACTTGGG - Intronic
1029380669 7:100212320-100212342 CACCAGCAGCAGTTCCTCCTGGG - Intronic
1032571942 7:133009968-133009990 CTCCAGGAGCAGTGTTTTTTTGG - Intronic
1034209270 7:149348841-149348863 CTCCAGGGGCAGTGTCCCAGTGG + Intergenic
1035400318 7:158560669-158560691 CACCATGAGCAGGGGCACATGGG + Intronic
1037468458 8:19184002-19184024 CTTCAGGATCAGTGACTCATTGG + Intergenic
1041882699 8:62770453-62770475 CAGCAGATCCAGTGTCTCATGGG + Intronic
1042159476 8:65877773-65877795 CACCTGGAGCACTCTCTCAGTGG - Intergenic
1043337594 8:79195791-79195813 CCCCAGCAACAGCGTCTCATTGG - Intergenic
1045950456 8:107845899-107845921 CAGCAGGAGCTGTGGCTCAGGGG - Intergenic
1047842850 8:128772921-128772943 GACCAAGAGAAGTGTCTTATTGG - Intergenic
1050245309 9:3683170-3683192 CAGGAGCAGCAGTGTCTCATTGG - Intergenic
1051696557 9:19774168-19774190 GACCAGGAGAAGTGTATCTTTGG + Intronic
1056545244 9:87607447-87607469 CAAGAGGGGCAGTGACTCATAGG - Intronic
1059357561 9:113711753-113711775 CACCTGGAGCAGCATCCCATTGG + Intergenic
1060325390 9:122609693-122609715 CACCAGGAGCACTGTCTCATGGG + Intergenic
1062604738 9:137341638-137341660 CACCAGGAGCCGTCTCCCAGGGG + Intronic
1062604773 9:137341772-137341794 CACCAGGAGCCGTCTCCCAGGGG + Intronic
1062604801 9:137341878-137341900 CACCAGGAGCCGTCTCCCAGGGG + Intronic
1062604846 9:137342056-137342078 CACCAGGAGCCGTCTCCCAGGGG + Intronic
1062604902 9:137342278-137342300 CACCAGGAGCCGTCTCCCAGGGG + Intronic
1062604914 9:137342324-137342346 CACCAGGAGCCGTCTCCCAGGGG + Intronic
1062604936 9:137342414-137342436 CACCAGGAGCCGTCTCCCAGGGG + Intronic
1185647031 X:1623239-1623261 CAGCAGGAGCTCTGTCCCATGGG - Exonic
1187071700 X:15894679-15894701 CATCAGCAGCTGTGTCTCCTGGG + Intergenic
1188808941 X:34628136-34628158 GACCAAGAGAAGTGCCTCATTGG + Exonic
1189498432 X:41530571-41530593 CCCCAGGATCAGTTTCTCACTGG + Intronic
1190190997 X:48277399-48277421 GACAAGGAGCAGGGTCTCAGGGG - Intronic
1190200238 X:48355069-48355091 GACAAGGAGCAGGGTCTCAGGGG - Intronic
1190385742 X:49880735-49880757 CACCAGGTGCAGTAACTTATAGG - Exonic
1190738947 X:53275441-53275463 GGCCAGGTGCAGTGGCTCATGGG - Intronic
1193067688 X:77276557-77276579 CAGCAGGGGCAGAGGCTCATTGG - Intergenic
1197288742 X:124628575-124628597 CTAAAGGAGAAGTGTCTCATTGG + Intronic
1198919896 X:141713684-141713706 CACCAGCAACATTTTCTCATTGG - Intergenic