ID: 1073277835

View in Genome Browser
Species Human (GRCh38)
Location 10:102328085-102328107
Sequence CGTCAAAAATAGATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073277835_1073277837 4 Left 1073277835 10:102328085-102328107 CCTAGCTCCATCTATTTTTGACG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1073277837 10:102328112-102328134 TGTTTTCCCCATCAGTAAAATGG No data
1073277835_1073277838 5 Left 1073277835 10:102328085-102328107 CCTAGCTCCATCTATTTTTGACG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1073277838 10:102328113-102328135 GTTTTCCCCATCAGTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073277835 Original CRISPR CGTCAAAAATAGATGGAGCT AGG (reversed) Intronic
913006558 1:114638461-114638483 CTTAAAAATTAAATGGAGCTGGG + Intronic
921327348 1:213999184-213999206 AGTTAAAAATAGCTGGAGTTCGG - Intronic
923727222 1:236517059-236517081 CGTCGATAATTGCTGGAGCTGGG + Intergenic
924218244 1:241847630-241847652 TGTCAAAAATAAACGAAGCTGGG + Intergenic
1065940472 10:30559794-30559816 AGTCAATAATAGTTTGAGCTGGG - Intergenic
1069781197 10:70956721-70956743 CCTGAAAAATAAATGGGGCTTGG + Intergenic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1073672140 10:105603687-105603709 CCTCTTAAATAAATGGAGCTGGG + Intergenic
1074701195 10:116094181-116094203 CTTCATAAATAGATAGAGCCGGG + Intronic
1075036536 10:119074045-119074067 AGTCAAAAATAAATGTAACTTGG - Intronic
1075040138 10:119101618-119101640 TGTCACAGACAGATGGAGCTGGG - Intergenic
1076203981 10:128580606-128580628 CCTCAAAAATAGAAGAAACTTGG + Intergenic
1081380983 11:42414976-42414998 AGTCAAAGATAGATCAAGCTGGG + Intergenic
1082120447 11:48374187-48374209 CCTCCCAAATAGCTGGAGCTGGG + Intergenic
1084042964 11:66553256-66553278 CCCAAAAAATAGATGCAGCTGGG + Intronic
1087790848 11:102404898-102404920 AGTCAAAAATAAATATAGCTGGG - Intronic
1090993731 11:131845306-131845328 AGACAAAAATAAATGGAGGTTGG + Intronic
1093187845 12:16042215-16042237 CATCAGAAATAGAGGCAGCTTGG + Intergenic
1093914084 12:24781212-24781234 CATGAACAATAGATGGTGCTAGG - Intergenic
1099982718 12:89625286-89625308 CCCCAAAAATAGAGGCAGCTGGG + Intronic
1103164543 12:118758814-118758836 AGTCAAAAATACAAAGAGCTAGG - Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1103445228 12:120990073-120990095 TGTCACACATAGATGGAGGTTGG - Intronic
1106098952 13:26677929-26677951 TTTCAAAAATAGATGCAGATGGG + Intronic
1109997718 13:70151430-70151452 CAGCAAAAATAGATGAACCTGGG - Intergenic
1119607514 14:76033422-76033444 CCTCCAAAACAGACGGAGCTTGG + Intronic
1121755191 14:96396400-96396422 CAGCAAAAAGAGATGGGGCTGGG - Intronic
1125153095 15:36555890-36555912 TGTCAAAAATTAATTGAGCTGGG - Intergenic
1126059739 15:44768791-44768813 AGTCAAAAGTAGATGGAGGTTGG - Intergenic
1126746532 15:51830786-51830808 CGTCAAAAATATATTAGGCTTGG + Intronic
1131383136 15:91981017-91981039 AGCCAAAAATAGATGGTCCTGGG + Intronic
1131409398 15:92194186-92194208 AGTCAAAAGAAGATGGAACTGGG + Intergenic
1138182553 16:54951794-54951816 CATCAAAAACATATGGACCTGGG - Intergenic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1150900828 17:69275137-69275159 CGTGAAAAGTAAATGGGGCTGGG - Intronic
1155549824 18:26953270-26953292 CTTCAAAAATGGATGGAAGTTGG + Intronic
1158063754 18:53379708-53379730 CATCCAAAATAGATGGCTCTTGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1164144396 19:22502677-22502699 GCTCAAAACAAGATGGAGCTTGG - Intronic
1165112960 19:33512906-33512928 GGTCATAAGTAGGTGGAGCTTGG - Intronic
1167960620 19:53102205-53102227 AGGCAGAAATAGATGGAGATTGG - Intronic
1167971729 19:53192179-53192201 AGGCAGAAATAGATGGAGATTGG - Intronic
929204657 2:39277206-39277228 TGGTAACAATAGATGGAGCTGGG - Intronic
929388246 2:41437236-41437258 CTTCAATAATAAATGGTGCTTGG - Intergenic
930858679 2:56046109-56046131 CGTTAAAAATACATAGAACTTGG - Intergenic
934691891 2:96367485-96367507 GTTCAAAAATACAAGGAGCTGGG + Intronic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
938169007 2:129058393-129058415 TGTCAAATAAAGATGGGGCTGGG - Intergenic
939416968 2:141912504-141912526 AGTGAAAAGAAGATGGAGCTAGG + Intronic
940990805 2:160094405-160094427 CTTCAAAAATAAATGGTGCTGGG + Intergenic
942143225 2:172998963-172998985 CCTCTAAAAGAGATGGAGATTGG + Intronic
942383889 2:175421328-175421350 TACAAAAAATAGATGGAGCTGGG + Intergenic
945005583 2:205401827-205401849 CTTCACAACTAAATGGAGCTTGG + Intronic
1172031147 20:31983023-31983045 AGTCAGTAAGAGATGGAGCTAGG + Intronic
1183092587 22:35532968-35532990 CAGCAATAATTGATGGAGCTGGG - Intergenic
952130126 3:30352413-30352435 CTTGAAAAATAGAAAGAGCTGGG + Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
953426578 3:42799749-42799771 AGCCAAAAAAAGATGGAGCCAGG - Intronic
954976664 3:54702019-54702041 ATTCAAAAATAAATGGTGCTGGG + Intronic
955339124 3:58111459-58111481 CGACAATAATACATGGGGCTGGG - Intronic
962463838 3:135638903-135638925 TGTCAAAAAGAGATGCAGCAGGG + Intergenic
963233968 3:142937503-142937525 CTTCAAGAATAGCTGGATCTAGG - Intergenic
963569155 3:146970339-146970361 CGTGACAATTAGTTGGAGCTAGG + Intergenic
965024053 3:163275524-163275546 CGTGAAAAAAAGAGGGAGGTAGG + Intergenic
966494905 3:180568849-180568871 TATCAAAAAATGATGGAGCTCGG - Intergenic
966702347 3:182868685-182868707 AGTCAGAAAAACATGGAGCTGGG + Intronic
970924314 4:21433304-21433326 GGACAAAAATATATGGGGCTGGG + Intronic
972886281 4:43493218-43493240 CAGGAAAAATAGAGGGAGCTGGG + Intergenic
974180937 4:58383910-58383932 CTTCAAAAATAAATGAATCTGGG - Intergenic
974570733 4:63645100-63645122 CCTCAAAAGTAGATGGTGATTGG + Intergenic
981119852 4:141037889-141037911 CCTCTAAAATAGATGTATCTGGG - Intronic
982469677 4:155773172-155773194 TCACAAAAATACATGGAGCTTGG - Intronic
984134226 4:175915655-175915677 CAACAAAAATATAAGGAGCTAGG + Intronic
984214930 4:176899341-176899363 CTTGTGAAATAGATGGAGCTAGG + Intergenic
985161403 4:187048250-187048272 GTTCAAAAATGGATGGTGCTTGG - Intergenic
986965928 5:13270930-13270952 TTTCAAAAAGAGATGGATCTAGG + Intergenic
990175822 5:53107162-53107184 CGTCAAGAATATGTCGAGCTTGG - Exonic
990815190 5:59776885-59776907 TTTAAAAAATATATGGAGCTGGG + Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
991297855 5:65100829-65100851 CTTCAAAAGGAGATGGAGGTGGG - Intergenic
991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG + Intronic
992849619 5:80793856-80793878 TGTCAAAGCTAAATGGAGCTGGG + Intronic
995931279 5:117448927-117448949 TGAGAAAAATAGATGAAGCTTGG + Intergenic
1014048174 6:116918708-116918730 CTCCAAAAATAGATGTTGCTTGG + Intronic
1015413917 6:132926989-132927011 CAGCTAAAATATATGGAGCTAGG - Intergenic
1017899740 6:158708948-158708970 AGTCAAAAATATATTTAGCTAGG + Intronic
1020427804 7:8089863-8089885 AGTCAAGAAGAGATGGGGCTAGG - Intronic
1027919552 7:84375361-84375383 CGTGAACAATGAATGGAGCTTGG - Intronic
1028444573 7:90905843-90905865 GTTAAAAAATAGATGTAGCTTGG + Intronic
1030109946 7:106018529-106018551 CCTCAAAAAAATATGGGGCTGGG - Intronic
1031700672 7:124921235-124921257 TGTCAAAACTAGATGCAGCTTGG + Intronic
1031941233 7:127791654-127791676 TGTCAAAAATAAGTGGAGCTGGG - Intronic
1037536407 8:19828387-19828409 CGTCATAAATGGCTGGTGCTGGG + Intronic
1042527268 8:69776401-69776423 CTTCAAAAAAAGATTGGGCTGGG + Intronic
1044389987 8:91638734-91638756 CATAAAAATTAGATGGGGCTGGG - Intergenic
1044730627 8:95226019-95226041 GGTCAAAAATTGAAGGAGCTGGG - Intergenic
1047732768 8:127739764-127739786 CCTCAAAAATAGGAGGTGCTTGG + Intronic
1048515153 8:135101010-135101032 CATGAAAAATTGATGGATCTTGG - Intergenic
1052030980 9:23628631-23628653 CATCTCAAATACATGGAGCTTGG + Intergenic
1058954573 9:109933627-109933649 CTTCAAAGATAAAGGGAGCTGGG - Intronic
1185475741 X:414227-414249 TGTCAAAAATAAAAGGAGCAGGG + Intergenic
1186050944 X:5594563-5594585 TGACAAAATTACATGGAGCTAGG - Intergenic
1188002735 X:24997490-24997512 CTTCAAAAAGAGATGCTGCTGGG - Intergenic
1190931431 X:54951978-54952000 CGGCAAAGGTAGATGGAGCGAGG + Exonic
1192236363 X:69298726-69298748 CGTCAAATTTACATGGTGCTTGG - Intergenic
1193039589 X:76990520-76990542 CTTCAAAAATCAATGGATCTAGG + Intergenic
1194534990 X:95095050-95095072 CGTCAAAAGAAGTTGGAGCCAGG - Intergenic