ID: 1073280499

View in Genome Browser
Species Human (GRCh38)
Location 10:102350536-102350558
Sequence CTCAGAACAAGAACCAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073280499_1073280502 -2 Left 1073280499 10:102350536-102350558 CCCTACCTGGTTCTTGTTCTGAG 0: 1
1: 0
2: 0
3: 24
4: 300
Right 1073280502 10:102350557-102350579 AGTCAAAAACTCTTGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073280499 Original CRISPR CTCAGAACAAGAACCAGGTA GGG (reversed) Intronic
900171324 1:1270500-1270522 CCCAGAACAAGAAGCAGGGTTGG - Intronic
901205767 1:7495000-7495022 CTCAGGACAAGAAGCAGGAGAGG - Intronic
904223641 1:28995201-28995223 TTCAGACCAAGATCCAGATATGG + Intronic
905056384 1:35097600-35097622 CTATGATCAAGAACAAGGTAGGG - Intronic
905096770 1:35478960-35478982 CTCAGCACCATACCCAGGTAAGG - Exonic
905185555 1:36193851-36193873 ATTAGCACAAGACCCAGGTATGG - Intergenic
909234911 1:73140548-73140570 CTCAGAACAGGAACAAGACAAGG - Intergenic
909234941 1:73140802-73140824 CTCAGAACAAGAACAAGACAAGG + Intergenic
911403209 1:97402674-97402696 CTAAGATCAAGAACAAGGCAAGG - Intronic
912620745 1:111154550-111154572 CTAAGAACTAGAACCAGACAAGG - Intronic
915993704 1:160543296-160543318 CTAAGGCCAAGTACCAGGTAGGG + Intronic
917602382 1:176589446-176589468 CTCAGATTAAGTACAAGGTAAGG + Intronic
917734071 1:177904575-177904597 ATCAGGAGAAGAACCAGGAAGGG - Intergenic
918264064 1:182823495-182823517 CTAAGAACAGGAACAGGGTAGGG + Intronic
918508759 1:185286896-185286918 CTCAGATCAAGAACACGATAAGG - Intronic
921003582 1:211069409-211069431 ATCAGAACCAGACCCAGGTATGG + Intronic
921675460 1:217970606-217970628 CTGAAAACAAGAACCAGAAAAGG - Intergenic
922973156 1:229760165-229760187 CTCAGCAGAAGGACCATGTAGGG + Intergenic
923457466 1:234176815-234176837 ATCACAACAAGAACCAGGAGAGG - Intronic
924122853 1:240820147-240820169 CATAGAACTAGAAACAGGTAAGG + Intronic
1063696553 10:8341164-8341186 CTAAGAACAAGAAGCAGTTTTGG - Intergenic
1065277065 10:24096158-24096180 CCCAGAAAAAGAAGCAGGCATGG - Intronic
1065757356 10:28944261-28944283 CTAAGATCAGGAACAAGGTAAGG - Intergenic
1066643948 10:37586016-37586038 CTTAGGAGAAGAACCAGCTAAGG + Intergenic
1066982816 10:42435159-42435181 CTGAGAACAGGAACAAGGCAAGG - Intergenic
1067451259 10:46383499-46383521 CTCGGACCAAGAACCAGCTGCGG + Intronic
1067585983 10:47476257-47476279 CTCGGACCAAGAACCAGCTGCGG - Exonic
1068048980 10:51925033-51925055 CTTAGAACCAAAACCATGTATGG - Intronic
1068096440 10:52497960-52497982 CTAAGAACTGGAACAAGGTAAGG - Intergenic
1068141309 10:53011382-53011404 CTCAGATCAAGAACAAGGCAAGG - Intergenic
1068441961 10:57068488-57068510 ATCAGAACTAGATTCAGGTATGG - Intergenic
1068494311 10:57766367-57766389 CTGAGACCTAGAACAAGGTAAGG - Intergenic
1068494418 10:57768204-57768226 CTTAGATCAAGAACAAGGCAAGG + Intergenic
1068600805 10:58954472-58954494 GTCAGAACCGGCACCAGGTAAGG + Intergenic
1070508438 10:77137997-77138019 ATCAGAACAGGAACCAGGACTGG - Intronic
1072110855 10:92318661-92318683 CTAAGAACAAGAACAAGATAAGG - Intronic
1073280499 10:102350536-102350558 CTCAGAACAAGAACCAGGTAGGG - Intronic
1075042791 10:119121845-119121867 CTCATAACAAGAACCCTGCAAGG + Intronic
1075775108 10:124978153-124978175 CTCAACACAAGAACTATGTATGG - Intronic
1076537565 10:131190794-131190816 CTGAGAACAAGAACAAGATAAGG + Intronic
1077717864 11:4599816-4599838 CTCAGCACAACAACCAGCTCTGG + Exonic
1078958760 11:16237419-16237441 CTCAAAACAATATCCAGGTATGG + Intronic
1079127064 11:17724655-17724677 CTCAGGAGGAGAAGCAGGTATGG + Intergenic
1079338096 11:19589034-19589056 CACAGAGGAAGGACCAGGTATGG - Intronic
1080573396 11:33577251-33577273 CTGAGAAGAAGAACAAGGTGTGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1084087250 11:66860276-66860298 CTGAGAATAAAAACCAGGGAGGG - Exonic
1085250746 11:75142074-75142096 CTCAGAACAGGGACCAGGGAGGG + Intronic
1085916697 11:80897722-80897744 CTAAGATCAAGAACAAAGTAAGG - Intergenic
1090579023 11:128139867-128139889 CTCAGAACCAGATACAGATATGG + Intergenic
1093228914 12:16518904-16518926 CTCAGAACCAGAACTAAATAGGG + Intronic
1093416212 12:18923972-18923994 CAAAGATCAAGAACCACGTAAGG + Intergenic
1093669744 12:21859337-21859359 CTCAGAAAAACAACCACTTAGGG + Intronic
1093697762 12:22181500-22181522 CTCAGAACCAGATTCAGATATGG + Intronic
1093810055 12:23481441-23481463 CTCAGAATAAGAGCCATCTATGG + Intergenic
1093848333 12:24003233-24003255 CTAAGATCAGGAACAAGGTAAGG + Intergenic
1094789323 12:33892820-33892842 CTAAGATCAAGAACAAGGCAGGG + Intergenic
1095825623 12:46527758-46527780 CTGAGATCAAGAACAAGGCACGG + Intergenic
1096521695 12:52188140-52188162 CTCAGAACAAGGACCTGGGGAGG + Intronic
1097279561 12:57836333-57836355 CTCTCAAGAAGTACCAGGTAAGG + Intronic
1097296635 12:57972142-57972164 CTAAGATCAAAAACAAGGTAAGG + Intergenic
1097509852 12:60525062-60525084 CTAAGATCAAAAACCAGGCAAGG - Intergenic
1098261623 12:68677171-68677193 CTCAGAAAAAGAACAGGGGAGGG + Intergenic
1098370664 12:69757165-69757187 CTCAGAAAAAGAATAAGATATGG - Intronic
1098609115 12:72432878-72432900 CTAAGATCAAGAACAAGATAAGG - Intronic
1098928456 12:76380809-76380831 CTAAGATCAAGAACAAGGCAAGG - Intronic
1100017815 12:90033188-90033210 CTAAGATCAGGAACAAGGTAAGG - Intergenic
1100147349 12:91694169-91694191 CTAAGATCAAGAACAAGGTAAGG + Intergenic
1100344867 12:93718719-93718741 CTAAGACCAGGAACCAGGCAAGG - Intronic
1102851862 12:116254164-116254186 CCAAGAACAGGAACAAGGTAAGG + Intronic
1104640650 12:130464842-130464864 CTCTGAACAAGAGCCAGGCAGGG + Intronic
1104948430 12:132427756-132427778 CTTAGATCAAGGATCAGGTATGG + Intergenic
1105942604 13:25162841-25162863 CTCTTCACAAGAACCATGTAAGG - Intronic
1106096581 13:26650463-26650485 ATCAGAACAAGATTCAGATATGG + Intronic
1106183051 13:27384531-27384553 CTCATAACAAGATCCTGGGAGGG - Intergenic
1106605709 13:31226425-31226447 CACAGGACATGACCCAGGTATGG + Intronic
1108012672 13:46035980-46036002 GGCAGAAAAAGAACAAGGTAAGG + Intronic
1108179262 13:47824873-47824895 CTAAGAACAGGACCCAGGGATGG + Intergenic
1109898877 13:68735703-68735725 CTCAGACCAGGAACAAGGCATGG - Intergenic
1110480633 13:75971064-75971086 CTGAGAACAAGAGGGAGGTAGGG + Intergenic
1110783826 13:79499308-79499330 ATTAGAACAAGAACCAGGCAAGG + Intronic
1111965737 13:94859615-94859637 CTAAGGACAAGAAGCAGGTGCGG - Intergenic
1113166770 13:107451435-107451457 CTCAGAACAAACAGCAGTTATGG + Intronic
1113340959 13:109425477-109425499 CTCAGAAGCAAAACCATGTATGG + Intergenic
1114539294 14:23442975-23442997 CTGAGAACAAGACCCAGGACAGG - Intergenic
1114798553 14:25744071-25744093 AAAAGAACATGAACCAGGTATGG - Intergenic
1115703017 14:35973855-35973877 CTAACAACAGGAATCAGGTATGG - Intergenic
1116219594 14:42066083-42066105 CTGAGAACCAGAACAAGGCAAGG - Intergenic
1116319754 14:43446505-43446527 TTGAGAACCAGAACAAGGTAAGG + Intergenic
1118496298 14:66311120-66311142 TTGAGAAAAAGAACCAGGAAGGG + Intergenic
1118860609 14:69660090-69660112 CTCAGAACTAGATCCTGGAAGGG + Intronic
1120016910 14:79484305-79484327 CTAAGATCAGGAACCAGGAAGGG - Intronic
1120110822 14:80553586-80553608 TTCTGAAGAAGAACAAGGTAAGG - Intronic
1120489080 14:85153667-85153689 CTCAAAACAATAACCAAGTTGGG + Intergenic
1121779036 14:96609827-96609849 CTCAAAAACAGAACCAGGCAAGG - Intergenic
1121979753 14:98444265-98444287 CTCTGAAAAACAACCAGGTGTGG + Intergenic
1123979454 15:25587087-25587109 CTCAGAAATAGACCCATGTATGG + Intergenic
1126206866 15:46055902-46055924 CTAAGATCAGGAACAAGGTAAGG - Intergenic
1128871494 15:71159844-71159866 CTAAGAACAGGAACAAGGTAAGG - Intronic
1130244734 15:82235774-82235796 CTAAGACCAAGAACAAGGCAAGG + Intronic
1130684442 15:86024521-86024543 GTCTGGACAAGAACCAGGTGAGG + Intergenic
1136020799 16:27438563-27438585 CACAAAACAAGAACCAGGGCAGG + Intronic
1137827259 16:51509716-51509738 CTCAAAGTAAGAAGCAGGTAAGG - Intergenic
1138224755 16:55283098-55283120 CTAAGAACTGGAACCAGGAATGG - Intergenic
1138506657 16:57481537-57481559 CTCAGAGCAAGGACCAGCTCAGG + Intronic
1138975724 16:62205307-62205329 GGCTGAACAAAAACCAGGTAGGG + Intergenic
1138996803 16:62464676-62464698 ATAAGATCAAGAACCAGGCAAGG - Intergenic
1139142832 16:64288691-64288713 CTAAGTTCAAGAACAAGGTAAGG + Intergenic
1139372457 16:66477509-66477531 CTCAGACCAGGATCCAGGGATGG - Intronic
1139824306 16:69745099-69745121 CTCAGGAGAAGAAACAGGGAAGG + Intronic
1145229088 17:21158167-21158189 CTAAGATCAAGAACAAGGCAAGG + Intronic
1147441144 17:40447973-40447995 CTCAGAATAAAAAACAGATAAGG - Intronic
1147462805 17:40585164-40585186 CTGAGAACAGGAACAAGATAAGG - Intergenic
1148535264 17:48433366-48433388 CACAGAACAGGACCCAGGCAGGG - Intergenic
1149624380 17:58069724-58069746 CTCAGAATAAAAACCATGTGTGG + Intergenic
1149929353 17:60735370-60735392 CTAAGATCAGGAACAAGGTAAGG - Intronic
1151167478 17:72217860-72217882 CTCAGAACCAGAACAAGCCATGG + Intergenic
1151851664 17:76694213-76694235 CTCAGGACAAGCACATGGTAGGG - Intronic
1151918324 17:77135216-77135238 ATGTGAACAAGAACCAGGGAAGG - Intronic
1152610717 17:81313920-81313942 CTGTGAACAAAGACCAGGTAAGG + Exonic
1203167810 17_GL000205v2_random:114154-114176 CTCAGAGCAAGAATCAGGGCTGG + Intergenic
1153155026 18:2139180-2139202 CCAAAAACAAGAATCAGGTAAGG + Intergenic
1153493135 18:5670328-5670350 CTCTGAAGAAGAACCAGATTGGG + Intergenic
1156131486 18:33980851-33980873 ATCAGAACCAGACGCAGGTATGG + Intronic
1156625374 18:38901766-38901788 CTGAGAACAAGTGCCAGGGAGGG - Intergenic
1156733313 18:40222681-40222703 CTCAAAATAAAAACCAGATAAGG - Intergenic
1157099930 18:44720195-44720217 CTGAGAACAAGAGGCAGGTGAGG - Intronic
1158756846 18:60335495-60335517 CTGAGAACAGGAACAAGATAAGG + Intergenic
1160128368 18:76201168-76201190 CTGAGATCAAGAACAAGGCAAGG + Intergenic
1161124518 19:2548186-2548208 CAAAAAACAAAAACCAGGTATGG + Intronic
1162693678 19:12454612-12454634 CTGAGATCAGGAACGAGGTAAGG - Intronic
1166693825 19:44840946-44840968 CTCAGAATAAGAGCCGGGTATGG + Intergenic
925598202 2:5578895-5578917 CTCAGATCAAGTACAAGGCAAGG + Intergenic
926896615 2:17697137-17697159 CTAAGAACAAGAGCAAGGTAAGG + Intronic
928319277 2:30270240-30270262 CTTAGAACAAAAACCAGGGCTGG + Intronic
928457870 2:31439984-31440006 CTAAGAGCAAGAACAAGGCAAGG - Intergenic
931387304 2:61809227-61809249 CTGAGAAGAAGCAGCAGGTAAGG - Intergenic
931598264 2:63974980-63975002 CTAAGAACAGGATCAAGGTAAGG - Intronic
932085890 2:68760264-68760286 CTGAGATCAAGAACAAGGCAAGG + Intronic
932470870 2:71955636-71955658 CTAAGATCAAGAACAAGGCAAGG - Intergenic
932637109 2:73399711-73399733 CTAAGATCAAGAACAAGGCAAGG - Intronic
935038048 2:99398100-99398122 CCCATTACAAGAACCAGGTTTGG - Intronic
937716033 2:125033895-125033917 CTAAGAACTAGAACAAGATAAGG - Intergenic
938563933 2:132500147-132500169 CTAAGAACAGGAACAAGGCAAGG - Intronic
938908514 2:135862896-135862918 CACAGAACAAGAACCAAGATCGG - Intronic
939974492 2:148701325-148701347 CTAAGATCAAGAACAAGGCAAGG - Intronic
941596609 2:167484770-167484792 CTCAGAAAAAGAACTAGAAAGGG + Intergenic
941911846 2:170771304-170771326 CCCAGAGCCAGAACCAGGTGCGG - Intergenic
942270248 2:174267363-174267385 CTCAGAACAAGAAACAGGACGGG - Intergenic
942521569 2:176809476-176809498 CTCAAACCAAGCACCAGGTGTGG - Intergenic
944541389 2:200757027-200757049 CTCAGACCAAGAACAGGGTGAGG + Intergenic
945762049 2:213925645-213925667 CTCAAAACAAGAACAAGGCTGGG - Intronic
947369805 2:229433305-229433327 GTCAGAACATGTACCAGCTATGG + Intronic
949002092 2:241620997-241621019 ATCAGAACCAGACTCAGGTACGG + Intronic
1170410845 20:16089640-16089662 CTAAGATCAAGAACAAGATAAGG + Intergenic
1171260840 20:23731938-23731960 CTAAGAATAAGAACAAGGCAAGG - Intergenic
1171269960 20:23807796-23807818 CTAAGAATAAGAACAAGGCAAGG - Intergenic
1173036891 20:39420450-39420472 CTGTGAACAGGAACCAGCTATGG - Intergenic
1173082866 20:39886545-39886567 CTCTGAACAAACACCAGGCAGGG - Intergenic
1173132578 20:40408479-40408501 ATCAGAACAAGGAGAAGGTAAGG - Intergenic
1174017584 20:47501563-47501585 CTCAAAACAAGCATCCGGTAGGG - Intergenic
1174206580 20:48844568-48844590 CTCAAAACAAGATACAGGAAAGG + Intergenic
1174884215 20:54314357-54314379 CACAAAACAGGAACCAGATAAGG - Intergenic
1175020334 20:55840449-55840471 CTAAGATCAAGAACAAGGCAAGG + Intergenic
1176161627 20:63651680-63651702 CTCAGAACAAGCCCCAGGAGAGG + Intronic
1176403947 21:6344982-6345004 CTCAGAGCAAGAATCAGGGCTGG - Intergenic
1176433210 21:6644122-6644144 CTCAGAGCAAGAATCAGGGCTGG + Intergenic
1177224393 21:18234799-18234821 CCCAGAACCAGAACCATGTCTGG - Intronic
1178059795 21:28839297-28839319 CTGAGAACAGGAACAAGGCAAGG + Intergenic
1178421913 21:32450097-32450119 CTCAGAATAAGAATATGGTAAGG + Intronic
1181717089 22:24738861-24738883 CTCAGAAAATGAACCAAATAAGG + Intronic
1183433225 22:37778505-37778527 CTCAAAACAAAAGCCAGGCATGG + Intergenic
1184611976 22:45610029-45610051 CACACAACAATAACCAGGCATGG + Intergenic
1185303540 22:50098736-50098758 CTAAGATCAGGAACCAGGCAAGG - Intronic
949309729 3:2683662-2683684 AACAGAACAAGAACCCAGTAAGG + Intronic
949686663 3:6581004-6581026 CTAAGATCAAGAACAAGGCAAGG + Intergenic
949983354 3:9517983-9518005 CTAAGATCAAGAACAAGGCAAGG - Intronic
949987425 3:9552227-9552249 CCCAGAACAAGCGCCAGGGACGG - Intronic
949993377 3:9597813-9597835 CTGAGAAAGAGAACAAGGTAAGG - Intergenic
951739058 3:25899666-25899688 CTCAGAACTACAACCCAGTAAGG - Intergenic
952520817 3:34155554-34155576 CTCAGCCCAAGTACCAGGCATGG + Intergenic
954141088 3:48605931-48605953 CTCAGTACAAGCCCCAGGCAGGG + Intronic
954720085 3:52554155-52554177 CTTAGAACAAAAAGCAGGGAGGG - Intronic
955270540 3:57493939-57493961 CTAAGATCAAGAACAAGATAAGG + Intronic
956939057 3:74136105-74136127 ACCAGAATAAGAACGAGGTAGGG + Intergenic
958443755 3:94189596-94189618 CTAAGAACAGGAACAAGGCAAGG - Intergenic
959662453 3:108884130-108884152 CTCTGAACAAGCACTAGGAAAGG - Intergenic
959720055 3:109476777-109476799 CTAAGAACAGGAACAAGATAAGG - Intergenic
959753545 3:109868090-109868112 CTAAGATCAAGAACAAGGCAAGG + Intergenic
959890250 3:111546730-111546752 TCCAGAACAAGCAACAGGTATGG + Intronic
960261028 3:115568408-115568430 CTAAGAACTAGAACAAGATAAGG + Intergenic
960332013 3:116371612-116371634 CTCAGATCAAGAACAAGGCAAGG + Intronic
960383886 3:116996095-116996117 CTCAGAACAATACCCATGTGGGG - Intronic
960756273 3:121017366-121017388 CTAAGATCATGAACAAGGTAAGG + Intronic
960822936 3:121753263-121753285 CTAAGATCAGGAACAAGGTAAGG + Intergenic
961244508 3:125439930-125439952 ATTAGAAAATGAACCAGGTATGG + Intergenic
962314029 3:134347191-134347213 CTAAGATCAGGAACAAGGTAAGG + Intergenic
962454952 3:135556579-135556601 CCCACAACACTAACCAGGTAGGG + Intergenic
962506261 3:136049140-136049162 CTCAGATCAACAATCAAGTAAGG - Intronic
962514067 3:136132188-136132210 CTGAGATCAAGAACCAGGCAAGG + Intronic
963891718 3:150642974-150642996 CTAAGAACTGGAACAAGGTAAGG + Intergenic
965563365 3:170083118-170083140 GTCAGAAGAAGAATCAGGAAAGG - Intronic
966301638 3:178485618-178485640 CACAGAGAAAGAACCATGTAAGG + Intronic
967635950 3:191803128-191803150 CTAAGATCAAGAACAAGGCAAGG + Intergenic
968290098 3:197532642-197532664 CAGACAACAAGAACAAGGTAGGG - Intronic
969837544 4:9855036-9855058 TTGAGAACTAGAACCAGATAAGG + Intronic
970084378 4:12329719-12329741 CTAAGATCAAGAACCCAGTAAGG - Intergenic
974170215 4:58257031-58257053 CTAAGATCAGGAACAAGGTAAGG + Intergenic
974318102 4:60307675-60307697 CAGAGAACAAGAACTAGGAATGG + Intergenic
975739669 4:77417451-77417473 CTCAGAACAAGAATCACTGAGGG + Intronic
975773890 4:77761698-77761720 CTAAAATCAAGAACAAGGTAAGG + Intronic
977572086 4:98639169-98639191 CTGAGACCAAGAACCCCGTAAGG - Intronic
977737805 4:100438647-100438669 CTCAGATCCAGTACTAGGTAAGG - Intronic
978213524 4:106168420-106168442 CTAAGATCAGGAACAAGGTAAGG + Intronic
978556383 4:109985235-109985257 CACAGAACACAATCCAGGTATGG - Intronic
978770554 4:112452149-112452171 CTCACAGCAAAACCCAGGTAGGG - Intergenic
978886217 4:113769241-113769263 TCCAGAACATGAACCAGGTCTGG - Intergenic
981163943 4:141534501-141534523 CTAAGATCAAGAACAAGGCAAGG + Intergenic
981404606 4:144353672-144353694 CTCAGAATAAGAAGGAGGTAGGG - Intergenic
981521184 4:145664122-145664144 ATCAGAACAAGACTCAGATACGG + Intergenic
981921749 4:150092867-150092889 CTAAGATCAAGAACAAGGCAAGG + Intronic
982135558 4:152271241-152271263 AGCAGAGCAAGAACCAGGTGGGG - Intergenic
982236597 4:153256715-153256737 ATCAGAAGAAGAACAAGGTCTGG + Intronic
982290413 4:153775857-153775879 CTAAGATCAAGAACAAGGCAAGG - Intergenic
982661008 4:158206913-158206935 CTCAGAACCAGATTCAGATATGG - Intronic
987185473 5:15413013-15413035 CTGAGAACTAGAACAAGATAAGG + Intergenic
987434036 5:17871711-17871733 CTAAGATCAAGAACAAGATAAGG + Intergenic
987893549 5:23915541-23915563 CTGAGAACCAGAACAAGATAAGG + Intergenic
990202061 5:53386701-53386723 ATCAGAATCAGACCCAGGTATGG + Intergenic
991090050 5:62685525-62685547 CACAGAACAACAACCAGGGTTGG + Intergenic
994469002 5:100178161-100178183 CTCAAGCCAAGAACCAGTTAAGG + Intergenic
995046354 5:107653075-107653097 ATCAGAACAGGTACCAGGGAGGG + Intronic
995807189 5:116066493-116066515 CCAAGATCAAGAACAAGGTAAGG - Intergenic
996715983 5:126588474-126588496 CTCAGAATAAAAACCAGTTCAGG + Intronic
996924246 5:128804881-128804903 CTCAGATCAGGAACAAGGCAAGG - Intronic
997058525 5:130473453-130473475 CTGAGAACAAGAACAAGACAAGG - Intergenic
998528433 5:142863492-142863514 CCCAGAAAAAGAACCAGAAATGG - Intronic
998755577 5:145375557-145375579 CTCAGAACTAGAAGGAGGAAAGG + Intergenic
999045218 5:148459803-148459825 ATCAGAACCAGAATCAGATATGG + Intronic
1001196265 5:169676104-169676126 CTGAGAAGAAGGACCAGGAATGG + Intronic
1002548242 5:179967109-179967131 CACAGGAAAAGAACCTGGTAAGG - Intronic
1005037239 6:21568469-21568491 CTCAGAAAAAGAACTAAATAAGG - Intergenic
1006175351 6:32117935-32117957 CTCAGAGCAAGAGCCAGTTCAGG - Exonic
1006380567 6:33694919-33694941 TTCAGAACAAGAACCTGGACTGG + Exonic
1007776645 6:44227711-44227733 ATCAGATCAAGAACCAGGGTGGG - Intronic
1008273861 6:49520713-49520735 CTAAGAACAAAGACCAGGAAGGG + Intronic
1008312884 6:49999077-49999099 CTAAGATGAGGAACCAGGTAAGG + Intergenic
1008511163 6:52277061-52277083 CACAGACCAGGAAACAGGTAAGG - Exonic
1008836647 6:55840423-55840445 CTCAGATAAAGAATCAAGTAAGG - Intronic
1010610527 6:77949386-77949408 TTCAGAACCAGAACAAGGCAAGG + Intergenic
1010646637 6:78396919-78396941 GTGAGAAAAAGAACTAGGTAAGG - Intergenic
1010817205 6:80372513-80372535 CTGAGAACTAGAACAAGATAAGG - Intergenic
1012669120 6:102018010-102018032 GTCAGAACAAGAGTCAGATATGG - Intronic
1013229721 6:108151395-108151417 CTAAGAAAAAGAATAAGGTAAGG + Intronic
1015020968 6:128474460-128474482 CTTAGAACAAGAACAAGCTGTGG + Intronic
1015237379 6:130986739-130986761 CTCAGAACATGAGCCGGGTGTGG - Intronic
1015303178 6:131677348-131677370 CACAGAACCAGAGCCAGATATGG + Intronic
1015757382 6:136621402-136621424 GTCAGAACCTGAACCAGATATGG - Intronic
1017276162 6:152571212-152571234 CTCAGAAGACAAACCAAGTAGGG - Intronic
1017367491 6:153661301-153661323 CTAAGATCAAGAACAAGGCAAGG - Intergenic
1019777025 7:2917951-2917973 CTCAAAACAAGAACAAGGCTGGG - Intronic
1019948770 7:4353258-4353280 CTAAGATCAGGAACAAGGTAAGG - Intergenic
1020907696 7:14084989-14085011 TTCAGAACAAGACATAGGTATGG - Intergenic
1021114689 7:16734264-16734286 CTCAGAACAAGAAAAAGGAGAGG + Intergenic
1021953550 7:25799694-25799716 CTCAGAAAAAAAACTAGGAAGGG - Intergenic
1023763653 7:43490337-43490359 CTCAGAACCAGAACCAGAAAGGG - Intronic
1024578540 7:50783250-50783272 GTCAGAGCAAGAACCAGGAAGGG + Intronic
1024792999 7:52987690-52987712 ATCAGAACCAGCATCAGGTATGG + Intergenic
1025781538 7:64606368-64606390 CTCATAACAAGAGCCAGGAAAGG + Intergenic
1028020372 7:85764200-85764222 CTCAGAAGGAGAACCCTGTAGGG - Intergenic
1031482299 7:122292986-122293008 GCCAGAACCAGAACCAGGCATGG - Intergenic
1031791201 7:126107174-126107196 CTAAGAACAGGAACAAGATAAGG + Intergenic
1032266651 7:130374383-130374405 CCCAGAGCAAGAGCCTGGTAAGG - Intergenic
1033657550 7:143383306-143383328 CTCAGAACCAAAACCAGGTGAGG + Exonic
1034025111 7:147693907-147693929 CTAAGATCAGGAACAAGGTAAGG - Intronic
1034376792 7:150652543-150652565 CTGAGAACTAGAACCAGACAAGG - Intergenic
1034851388 7:154497305-154497327 CTCAGAAAAAGAACTAGGACAGG + Intronic
1035357644 7:158286415-158286437 CTAAGATCAGGAACCAGATAAGG - Intronic
1036468024 8:9020859-9020881 CTCAGAACAGGAACCAGTTCTGG - Intronic
1036520468 8:9487017-9487039 CTCAAAACAAAATCCAGGTTTGG + Intergenic
1037970973 8:23171665-23171687 CTCAGAACATGGACCAGGGTGGG + Intergenic
1038530948 8:28317603-28317625 CACAGAGCAACAACCACGTAGGG - Intronic
1040550864 8:48436426-48436448 AGCAGAACAAGAACCATGTCAGG - Intergenic
1040601212 8:48885435-48885457 CTCAGAACATGAAGGAGGTTTGG + Intergenic
1040767749 8:50935385-50935407 CTCAGAACCAGAATCAAATATGG + Intergenic
1041566020 8:59280096-59280118 CTCAAAAAAAAAACCACGTATGG - Intergenic
1041892330 8:62883621-62883643 CTAAGATCAAGAACAAGGCAAGG - Intronic
1042188555 8:66162082-66162104 CTGAGAACAAGAACAAGACAAGG - Intronic
1043518122 8:81015364-81015386 CTCAGGAAAAGAACCAGAGACGG - Intronic
1045089153 8:98721372-98721394 CTCAGAAAAATAGCCAGTTATGG + Intronic
1045311608 8:101008053-101008075 CACAGAAGAAGAAGGAGGTAGGG + Intergenic
1045725855 8:105172487-105172509 CTAAGATCAAGAACAAGATAAGG - Intronic
1047036603 8:120946317-120946339 CTAAGAACGAGAACAAGATAAGG - Intergenic
1048807402 8:138253521-138253543 CTTAGAACAAGTCCCAGGGATGG - Intronic
1048928367 8:139291043-139291065 CACAGAACAAGCCCCAGGTGGGG - Intergenic
1050097220 9:2079110-2079132 CCCTGAACAACAACCAGATACGG + Intronic
1050139675 9:2504258-2504280 TTTAGAACAATAACCAAGTAGGG + Intergenic
1050737947 9:8786115-8786137 CCCAGAATATGAACAAGGTAGGG + Intronic
1051981330 9:23023087-23023109 ATCAGAACGAGATTCAGGTACGG - Intergenic
1053589330 9:39495483-39495505 CTAAGATCAAGAACAAGGCAAGG + Intergenic
1054576969 9:66869806-66869828 CTAAGATCAAGAACAAGGCAAGG - Intronic
1055020163 9:71660791-71660813 CTCAGAACCAGACTCAGATATGG + Intergenic
1055675930 9:78660680-78660702 CAAAGAAAAAGAGCCAGGTACGG - Intergenic
1055774990 9:79758043-79758065 CTCAGAGTAAGAACCAGTTCTGG - Intergenic
1057414005 9:94845396-94845418 CTCAGAATAAAAACCCTGTAAGG - Intronic
1060763574 9:126276185-126276207 CTCAGAGCCAGAGCCAGGGAGGG - Intergenic
1061004984 9:127923656-127923678 CTCAGAGGAAGAACTTGGTATGG - Intronic
1061850276 9:133410792-133410814 CTCAAAACAAGAGCCTGGCATGG + Intronic
1062019169 9:134308264-134308286 CTCAGAACCAGAACCCTGGAGGG - Intergenic
1203438325 Un_GL000195v1:164548-164570 CTCAGAGCAAGAATCAGGGCTGG - Intergenic
1186142827 X:6594905-6594927 CTTAGAACAATTATCAGGTATGG - Intergenic
1187096962 X:16159081-16159103 CTCAGAACAAGTTCCAGGTGTGG + Intergenic
1187302532 X:18064964-18064986 CTCAGACCAAAATCCAGGTTTGG - Intergenic
1188364779 X:29302380-29302402 TTCAGAATAAAAATCAGGTAAGG + Intronic
1191797637 X:65038087-65038109 CACAGAAAAATAACGAGGTATGG + Intergenic
1193047074 X:77064798-77064820 CTCAGAGCCAGAACCAGGAGAGG + Intergenic
1193738412 X:85187391-85187413 CTAAGAACTAGAACAAGGTAAGG - Intergenic
1194632834 X:96307493-96307515 CTAAGATCAAGAACAAGGCAAGG + Intergenic
1196244298 X:113381330-113381352 CTAAGAACTAGAACCAGACAAGG + Intergenic
1197024058 X:121726224-121726246 CAAAGAACAAATACCAGGTAAGG - Intergenic
1198436308 X:136620102-136620124 CTCAGAACAAGAGGCCCGTATGG + Intergenic
1198992787 X:142535151-142535173 CTCAGAAAAAGAATCTGTTAAGG + Intergenic
1199283223 X:146026737-146026759 CTAAGATCAGGAACCAGGTGAGG + Intergenic
1200002753 X:153070723-153070745 CACAGAAGAGGAACCAGGAACGG + Intergenic
1200004970 X:153079286-153079308 CACAGAAGAGGAACCAGGAACGG - Intergenic