ID: 1073283871

View in Genome Browser
Species Human (GRCh38)
Location 10:102375421-102375443
Sequence CATGGAGCCCATACGCAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073283871_1073283875 14 Left 1073283871 10:102375421-102375443 CCAGGTTGCGTATGGGCTCCATG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1073283875 10:102375458-102375480 AATGCAGCCAACATCCACTCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1073283871_1073283878 25 Left 1073283871 10:102375421-102375443 CCAGGTTGCGTATGGGCTCCATG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1073283878 10:102375469-102375491 CATCCACTCAGGTGATGACTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1073283871_1073283877 24 Left 1073283871 10:102375421-102375443 CCAGGTTGCGTATGGGCTCCATG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1073283877 10:102375468-102375490 ACATCCACTCAGGTGATGACTGG 0: 1
1: 0
2: 1
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073283871 Original CRISPR CATGGAGCCCATACGCAACC TGG (reversed) Exonic
901449240 1:9326010-9326032 CATGGAGCCCACACTCCTCCTGG - Intronic
905270107 1:36782113-36782135 CAATGAGCCCATATCCAACCGGG - Intergenic
905476329 1:38231020-38231042 CATGGATCCCATAGGCAATCTGG - Intergenic
922705757 1:227789240-227789262 CGTGGATCCCAGATGCAACCAGG - Intergenic
1063220214 10:3960229-3960251 AATGGAGACCAGATGCAACCAGG - Intergenic
1073283871 10:102375421-102375443 CATGGAGCCCATACGCAACCTGG - Exonic
1074431016 10:113394763-113394785 CATGGAGCACATACGTAGCAAGG - Intergenic
1076822489 10:132946406-132946428 CATGGAGCGTATCAGCAACCTGG + Intergenic
1079352493 11:19703574-19703596 CATGCAGCCCAAACACAGCCAGG - Intronic
1082933711 11:58635225-58635247 CAAAGAGCCCATACTCCACCAGG - Intergenic
1085281401 11:75333469-75333491 CACGGAGCCCACACCCAACTGGG + Intronic
1090058973 11:123447414-123447436 CAGGGAGCCCATATTCATCCAGG + Intergenic
1091844530 12:3645648-3645670 CATGGAGGTCATTGGCAACCTGG + Intronic
1095289810 12:40464859-40464881 CATGGGTCCCACATGCAACCTGG + Intronic
1122964762 14:105117553-105117575 CATGGCCCCCAAACCCAACCAGG + Intergenic
1123020503 14:105395769-105395791 CATGGAACCCACACACAACATGG - Exonic
1130193788 15:81760581-81760603 CTTGGAGCCCACAGGCATCCTGG - Intergenic
1134625191 16:15718335-15718357 CATGGAGGCCATGAGCGACCGGG - Exonic
1141669804 16:85485813-85485835 CCTGCAGCCCCTACCCAACCCGG + Intergenic
1143228859 17:5333707-5333729 CATGGAACCAATACAAAACCAGG - Intronic
1144858649 17:18285571-18285593 CAAGGTGCCCATGCGCCACCCGG - Intronic
1145012787 17:19379071-19379093 CATCGAGACCATAGGCAACGGGG + Exonic
1150884187 17:69066115-69066137 CATGGAACCCATATGCAATGAGG - Intergenic
1162463157 19:10825119-10825141 GGTGGAGACCATTCGCAACCTGG + Exonic
1165123533 19:33578719-33578741 CATGCAGCCCATAGGCAAGGGGG - Intergenic
1167774359 19:51545027-51545049 CCTGGAGCCCAGATGCAACAGGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
948516856 2:238509555-238509577 CATGCAGCCCAGAAGCAGCCTGG - Intergenic
948668029 2:239548437-239548459 CATGGTAGCCATGCGCAACCTGG - Intergenic
1176514464 21:7773863-7773885 CTTGGAGCCCATACTCAGGCTGG + Intergenic
1178648577 21:34404387-34404409 CTTGGAGCCCATACTCAGGCTGG + Intronic
1179961668 21:44770903-44770925 CATGGGGCCCACAGGGAACCAGG + Exonic
1181318893 22:21989728-21989750 CATGGAGCCCATGCTCCACTAGG + Intergenic
1185050008 22:48549350-48549372 CATGGAATCCATTCGCCACCAGG + Intronic
950038195 3:9902381-9902403 CATGAAGCCCATATGTACCCTGG - Intergenic
950263843 3:11560775-11560797 CATGGAGGCCGTACGAACCCTGG - Intronic
954620799 3:51994294-51994316 CAGGGAGCCAATACGCCACCTGG + Intronic
959093836 3:101932508-101932530 CCTGGTGCCCAGACGCCACCTGG - Intergenic
962002442 3:131312525-131312547 CCTGGAGCCCACACTCACCCTGG - Intronic
963598589 3:147358370-147358392 CATTGAGCCCATAGTCAACAGGG - Intergenic
968913677 4:3487992-3488014 CATGGAGCCCACAGGCCACACGG - Intronic
1004770878 6:18780267-18780289 CTTGGAGCATATACGCATCCTGG + Intergenic
1008581334 6:52910351-52910373 CAAGGAGCTCATACTCAACAGGG - Intergenic
1018872877 6:167796560-167796582 GATGGAGCCCACCAGCAACCGGG - Intronic
1019534312 7:1520586-1520608 CATGCAGTCCGTCCGCAACCCGG - Intergenic
1029545324 7:101207472-101207494 CATGGAGCCCAAATGCTGCCGGG + Intronic
1030411618 7:109188433-109188455 GATGGAGCCCAAAGGCAAACAGG - Intergenic
1048645428 8:136414325-136414347 CATGCAGGCCATAAGCAACTGGG - Intergenic
1049488314 8:142877763-142877785 CATGGAGCCCCCACGCACTCTGG - Intronic
1049493204 8:142915797-142915819 CATGGAGCCCCCACGCACTCTGG - Intronic
1054123338 9:61231892-61231914 CATTGTGCCCATACACACCCAGG + Intergenic
1061139169 9:128753808-128753830 CCTGGAGGCCATCCGCAAGCAGG - Exonic
1198156183 X:133963028-133963050 CACTGAGCCCATTCTCAACCGGG + Intronic
1198223576 X:134625186-134625208 CCTGGAGCCCAGCTGCAACCTGG - Intronic
1200135678 X:153873495-153873517 CATGTAGCCCAGAGGCAGCCAGG + Intronic
1200215589 X:154366827-154366849 CATCGAGCCCACAGGCAACATGG - Exonic