ID: 1073287293

View in Genome Browser
Species Human (GRCh38)
Location 10:102396579-102396601
Sequence CAATCCCCTGTGGCCTCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073287293_1073287298 20 Left 1073287293 10:102396579-102396601 CCGAAGGAGGCCACAGGGGATTG 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1073287298 10:102396622-102396644 AGAGTGCTGTAGTTTGGTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 148
1073287293_1073287299 21 Left 1073287293 10:102396579-102396601 CCGAAGGAGGCCACAGGGGATTG 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1073287299 10:102396623-102396645 GAGTGCTGTAGTTTGGTTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 118
1073287293_1073287297 14 Left 1073287293 10:102396579-102396601 CCGAAGGAGGCCACAGGGGATTG 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1073287297 10:102396616-102396638 CTGATCAGAGTGCTGTAGTTTGG 0: 1
1: 0
2: 3
3: 22
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073287293 Original CRISPR CAATCCCCTGTGGCCTCCTT CGG (reversed) Intronic
900137059 1:1122138-1122160 CCCTCCCCTGTGGCCTCAGTGGG + Intergenic
900956791 1:5891043-5891065 CAATTACTTTTGGCCTCCTTTGG - Intronic
902830282 1:19007992-19008014 CATCTCCCTGTGGCCTCCATGGG - Intergenic
905863109 1:41363176-41363198 CAAGCCCCTGTCCCCTCCTAAGG - Intronic
906142102 1:43539971-43539993 CAATCCCCTGTGGGCACCCTGGG - Intronic
912953394 1:114135890-114135912 CTCTTCCCTGTGGTCTCCTTAGG - Intronic
916029062 1:160861105-160861127 CAATCCCATCAGTCCTCCTTCGG + Intronic
917556587 1:176096491-176096513 CAGGCCCCTGAGGCCGCCTTGGG - Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
924145743 1:241072918-241072940 TAAACCTCTGTGGCCTCCCTGGG + Intronic
1062862385 10:821099-821121 CAACTCCCTGGTGCCTCCTTGGG + Intronic
1063552584 10:7047050-7047072 CAGTCCCTGGTGGCCTCATTTGG - Intergenic
1064156255 10:12905776-12905798 CAAGCCCCTGTGCCCTGCTTGGG + Intronic
1065342759 10:24722972-24722994 CCTTCCCCTGTGGCCACCTAGGG + Intronic
1067162230 10:43836776-43836798 CAATCCCTCGTGGCTTCCCTTGG + Intergenic
1067164868 10:43857249-43857271 CAATCACCTGTGTGCACCTTGGG - Intergenic
1067794357 10:49310034-49310056 CAAACCCCAGTGGCTTCCTGTGG + Intronic
1069613262 10:69789496-69789518 CATTCCCCTGTTGTCTCCCTTGG - Intergenic
1069854630 10:71433227-71433249 CCATCCCCTGTTGCTTCCTAGGG + Intronic
1073287293 10:102396579-102396601 CAATCCCCTGTGGCCTCCTTCGG - Intronic
1075921831 10:126219921-126219943 CAATTCCCAGTGGCCTTGTTTGG - Intronic
1078432155 11:11296412-11296434 GAATGCACTGTGACCTCCTTAGG + Intronic
1079469901 11:20768388-20768410 CTATGCTCTCTGGCCTCCTTTGG - Intronic
1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG + Intronic
1081912665 11:46710025-46710047 CAATCCCATCTGGCTTCCTCCGG - Intergenic
1082002490 11:47400629-47400651 CAATGCCAAGTGGCCTCCCTGGG + Intergenic
1086613187 11:88781739-88781761 CAATCTCCTCTGGCCACCTCAGG + Intronic
1090323943 11:125868844-125868866 CCATCTCCTGTGGACTCCTGAGG - Intergenic
1093059405 12:14587806-14587828 CAATCCCCTCTGTACTCTTTAGG + Intergenic
1094477286 12:30850948-30850970 CAATCCCCTGGGCCCTCTGTGGG + Intergenic
1102471183 12:113160789-113160811 TGATTCCCTGTGGCATCCTTAGG - Intronic
1109209959 13:59523937-59523959 TCATCCCCTGTTGCCTCCTTCGG + Intergenic
1113089507 13:106602462-106602484 CAAGCCTCTTTGGCCTCCCTGGG + Intergenic
1113815769 13:113169942-113169964 CCAGCCACTGTGGCCTCCCTGGG + Intronic
1116043578 14:39715737-39715759 CTATCCCCTCTTGCCTCCTCAGG + Intergenic
1119266468 14:73265561-73265583 CCTTCCCCGGTGGCCTCCATAGG - Intronic
1124486676 15:30123430-30123452 CAAGTCCCTGAGGCTTCCTTGGG + Intergenic
1124541754 15:30592409-30592431 CAAGTCCCTGAGGCTTCCTTGGG + Intergenic
1124548410 15:30654204-30654226 CAAGTCCCTGAGGCTTCCTTGGG + Intronic
1124756852 15:32414888-32414910 CAAGTCCCTGAGGCTTCCTTGGG - Intergenic
1127364154 15:58271822-58271844 CATTCTTCTGTGCCCTCCTTTGG + Intronic
1129466134 15:75725342-75725364 CAATCCCCGCTGGCTTCCTCTGG - Intronic
1130574718 15:85081652-85081674 CCATGCCCTGTGGGATCCTTGGG + Intronic
1130931308 15:88430141-88430163 CAGTCCCCTGCTGCCTCCCTAGG + Intergenic
1132974389 16:2704235-2704257 CAATCCCCCACGGCCTCCTGAGG - Intronic
1133130395 16:3673048-3673070 CACTCTCTTGTGTCCTCCTTAGG - Intronic
1133834444 16:9353893-9353915 CATTCTTCTGTGTCCTCCTTTGG - Intergenic
1135709270 16:24701213-24701235 CAGTCCCCTGCAGCCTCATTTGG - Intergenic
1136498527 16:30658510-30658532 CAAACTCCTGTTGTCTCCTTTGG - Exonic
1136564238 16:31060648-31060670 AAATTCCCTGTGCCCTTCTTGGG - Intergenic
1137024453 16:35458743-35458765 ATGTCCCCTGTGCCCTCCTTAGG + Intergenic
1141099870 16:81189358-81189380 CAAGCCCCAGTGGCCTCCCGTGG + Intergenic
1142260248 16:89039509-89039531 CCCTGCCCCGTGGCCTCCTTGGG + Intergenic
1142592700 17:1013337-1013359 CAGGCCCCTGTGGCCGCCGTGGG + Intronic
1144335877 17:14268523-14268545 CCAGCCCCTGTGGGCTCCTGGGG - Intergenic
1146452339 17:32984660-32984682 CATCTCCCTCTGGCCTCCTTGGG - Intronic
1150516898 17:65822300-65822322 CAATCCCCTGTGGGTACCTAAGG - Intronic
1153656883 18:7290724-7290746 CATTGCCCTGTGGCCTCCAGGGG + Intergenic
1155933519 18:31730858-31730880 CAATACCCAGAAGCCTCCTTTGG - Intergenic
1156856788 18:41791504-41791526 CATCCCCCTGTGTCCTCCTGAGG - Intergenic
1157207108 18:45710117-45710139 CAAACCCCTGTGTACTCCTGGGG - Intergenic
1157996985 18:52570291-52570313 AAATTCCCAGTGGCCTTCTTAGG + Intronic
1160210546 18:76874618-76874640 AAATCTCCTGTGTCCTCCCTGGG - Intronic
1160224867 18:77004922-77004944 GAAGCTCCCGTGGCCTCCTTTGG + Intronic
1160686024 19:436917-436939 CATTCCCGTGTGACCTCCTGCGG - Intronic
1161941987 19:7410911-7410933 CCACCCCCTGAGGCCTTCTTAGG - Intronic
1162452105 19:10761450-10761472 AAACCCCCTCGGGCCTCCTTGGG + Intronic
1162950565 19:14069835-14069857 CCTTCCCCTCTGGCTTCCTTGGG - Intergenic
1163490922 19:17616780-17616802 CAAAGCCCTGTGGCCTCCAACGG - Intronic
1163497870 19:17657091-17657113 CAATTCCCTGTGGCTTCCAAGGG - Intronic
1165080983 19:33305823-33305845 GAGTCCCCAGTGGCCTCCTGGGG - Intergenic
1165849064 19:38838652-38838674 CTTTCCCCTGTGGCCTCCAGAGG + Intronic
1166200915 19:41237594-41237616 CCATGCACTGTGGCATCCTTTGG + Intronic
1167095855 19:47374859-47374881 CAATCTCCTGTGTCCTCCATCGG + Intronic
1167114499 19:47480725-47480747 CGGTCCCCAGTGGCCTCTTTCGG + Intronic
1167592810 19:50413626-50413648 CACTCTCCTGTTGCATCCTTGGG + Intronic
1168465896 19:56600957-56600979 GAACCACCTGTGGCCTCTTTGGG - Intronic
925285974 2:2715880-2715902 CACTCCCCTGTGGCCTGAGTGGG - Intergenic
933866659 2:86524670-86524692 CAATCCCCTGTGGACACCGAGGG + Intronic
936154575 2:110039818-110039840 CCATCCCCAGTGGCCTCCCCTGG - Intergenic
936190108 2:110331596-110331618 CCATCCCCAGTGGCCTCCCCTGG + Intergenic
937345780 2:121124513-121124535 CAGACCCCTGGGGCCTCCCTGGG + Intergenic
939660105 2:144878744-144878766 CAATGCCCAGTTCCCTCCTTGGG - Intergenic
940665331 2:156601847-156601869 CAAATCCCTGTGGTCTCCATGGG - Intronic
940724121 2:157315524-157315546 TAAACCCCTTTGGCCTCTTTTGG + Intergenic
941749098 2:169116810-169116832 CAATCCACTGGGGTCTCGTTTGG + Intergenic
942804761 2:179917530-179917552 CAATCCATTGTGGCCACTTTTGG - Intergenic
947542068 2:230986389-230986411 CAAGCCCCTGAGGCCCCTTTGGG - Intergenic
948069143 2:235105843-235105865 CATTTCCCTGTGGCCTCCACTGG - Intergenic
948151345 2:235747363-235747385 CACTCCCCTGGGGCCTTCCTGGG - Intronic
1173400756 20:42723788-42723810 CCATCCCATGTGGGCTCCTTGGG - Intronic
1174555915 20:51395265-51395287 CAATCCCCTGTCACCTGCTAGGG - Intronic
1176255985 20:64153213-64153235 CGCTCCCCTGCCGCCTCCTTGGG + Intronic
1179148201 21:38787579-38787601 CAATCCCCTCTGGGCCCCTGGGG + Intergenic
1179481845 21:41683292-41683314 CAATGCCCTGTGGCCCCCACAGG + Intergenic
1181860290 22:25812865-25812887 GAGTCCCCTGTAGCCTCATTGGG - Intronic
1181887045 22:26029784-26029806 CAAGCCCCTGTGTCCTCAGTTGG + Intronic
1182058842 22:27382328-27382350 CCTTCCCCACTGGCCTCCTTTGG - Intergenic
1182223923 22:28781143-28781165 CAATCTCCTGAAGCTTCCTTCGG - Exonic
1182521311 22:30885941-30885963 CTGCCCCCTTTGGCCTCCTTGGG - Intronic
1183398465 22:37587015-37587037 CAATCCCCTGGGGCCTTTTATGG - Intergenic
1184903729 22:47464660-47464682 TGTTCCCCTGTGGCCTCCTGTGG - Intronic
950495012 3:13328527-13328549 CCATGCCCTGTTTCCTCCTTTGG + Intronic
950704941 3:14773717-14773739 CAGAGCCCTGTGGCCTCCTGGGG + Intergenic
951195337 3:19817365-19817387 CGATCCCCTGAGGCCTTCTGAGG - Intergenic
953627066 3:44580123-44580145 CAATCACCTGGGACCTCCTGTGG + Intronic
953805272 3:46062736-46062758 CAAGGCCCTGTTGCCTCCTGGGG - Intergenic
954346193 3:50001633-50001655 CAATCCCCTGTGGACACCAAGGG + Intronic
955492603 3:59498345-59498367 CAATCCCCTAGGGCCTTCTGAGG - Intergenic
956191343 3:66611123-66611145 CAAACTCCTCAGGCCTCCTTTGG + Intergenic
964770955 3:160224636-160224658 CAATCACTTGTAACCTCCTTAGG + Intergenic
968516366 4:1017263-1017285 CACTCCACTCTGGCCTCGTTCGG + Intronic
968698914 4:2045597-2045619 GGATCCCCTGTGGCCTGTTTGGG + Intergenic
972408682 4:38769986-38770008 CATTCCACTGTGGTTTCCTTGGG + Intergenic
976370749 4:84285853-84285875 CAGTCCCTTGTGGCTTCCCTTGG - Intergenic
976469271 4:85408484-85408506 CAATCTCCTGTGGCCTCTTCTGG - Intergenic
976759249 4:88530475-88530497 CACTCCCCTAAGCCCTCCTTAGG - Intronic
977580272 4:98717497-98717519 TGAGCCCCTGTGGGCTCCTTGGG + Intergenic
982853022 4:160342698-160342720 CAGTCCCCTGTGGCTTCCCTTGG + Intergenic
985528746 5:421445-421467 CGATGCCCTGTGGCCTCATCTGG + Intronic
985644460 5:1078435-1078457 CACACCCCTGTGGCCTCCCCAGG + Intronic
986615625 5:9614369-9614391 CTTTCCCCTGTGGCCTCTTTGGG - Intergenic
987786771 5:22510532-22510554 CAATCCCTTGTGGCTGCCTAAGG - Intronic
989136999 5:38165935-38165957 CACTCCCCTTTGGCCATCTTAGG + Intergenic
990802790 5:59624238-59624260 CCATCCCCTGTTCCATCCTTTGG + Intronic
1001140122 5:169137412-169137434 CAGCCCCCTGAGGCCTCCTCAGG - Intronic
1001156061 5:169273222-169273244 CCCTCTCCTGTGGCCACCTTTGG - Intronic
1001760405 5:174203624-174203646 CAGACCCCTGGGGCCTTCTTGGG + Intronic
1002959873 6:1904807-1904829 CAAAGCCCTGTTCCCTCCTTGGG + Intronic
1003112757 6:3263191-3263213 CCAGCCCCTGTGGGCTCCTCAGG - Intronic
1006020376 6:31114384-31114406 CAATCCACTCTGCCCTCCTTGGG + Intergenic
1006091730 6:31632393-31632415 CCCTCCCATGTCGCCTCCTTCGG - Exonic
1013480697 6:110550450-110550472 CCACCGCCTGTGGCCTCCTGTGG + Intergenic
1016533840 6:145089521-145089543 CAGTCCCCTGAGGCCTCCGCAGG + Intergenic
1017513766 6:155137628-155137650 CAATCCCCAGTGGCCTCAGCAGG - Intronic
1017763148 6:157586439-157586461 CAAAACACGGTGGCCTCCTTGGG - Intronic
1018179136 6:161205318-161205340 GAATGCCCTGTGTCCTCTTTGGG - Intronic
1024925818 7:54614317-54614339 CAATCACATGTGGCCTCCGTGGG - Intergenic
1028081517 7:86583761-86583783 CATTCCCCTGTGGATTCCTGGGG - Intergenic
1030108078 7:106003718-106003740 CAATGTCCTGTTGGCTCCTTAGG + Intronic
1031625378 7:123986400-123986422 CAATACACTGTGGCCTCATTAGG + Intergenic
1034859473 7:154583332-154583354 CAATCTCCTCAGGCCTCCTGTGG + Intronic
1035657761 8:1323638-1323660 CAATGCCCTGTGGCCTCTTCTGG + Intergenic
1035970054 8:4238055-4238077 CAATCTCTTGAGGCCTCCTAGGG - Intronic
1035972946 8:4271881-4271903 CAATCCCCTGTGGACACCAAGGG - Intronic
1037719583 8:21431272-21431294 CAGTCCCTTGTGGCTTCCCTTGG - Intergenic
1040700424 8:50056798-50056820 CAATCCCCAATTGCCTCCATGGG - Intronic
1040919410 8:52599726-52599748 CAGGCCCCTGAGGCCACCTTGGG - Intergenic
1043978880 8:86615176-86615198 CAATCCCCTGTGGATACCATGGG + Intronic
1045571052 8:103370171-103370193 TAACCCCCTCTGTCCTCCTTTGG - Intergenic
1047610661 8:126517699-126517721 CCATCCCCTGTAGCTTCCTAAGG + Intergenic
1047759234 8:127941925-127941947 CCATCCCCTTTGGCTTCCTCGGG + Intergenic
1048878378 8:138854294-138854316 CTGTTCCCTGTGGCCTACTTAGG - Intronic
1048885265 8:138904377-138904399 CCAACCCCTGCGGCCTCCCTGGG + Intronic
1049422260 8:142522199-142522221 CCATCCCCTGTGGACCCCTGGGG + Intronic
1051452034 9:17207560-17207582 CAGTCCCTTGTGGCTTCCCTTGG + Intronic
1052084052 9:24241889-24241911 CACTCTCCTGTGGCTTCTTTTGG + Intergenic
1053868820 9:42469125-42469147 CAACACCCTGTGGACTTCTTTGG + Intergenic
1055777122 9:79778622-79778644 CTATCTTCTGTGACCTCCTTGGG - Intergenic
1057516885 9:95729325-95729347 CAGTCCCCAGGGGCCTCCCTGGG + Intergenic
1060030739 9:120212832-120212854 AAATCCCAAGTGGCCTCCTCTGG - Intergenic
1060818063 9:126645806-126645828 AAATCCCCTGTGGCTCCCTTTGG - Intronic
1061353330 9:130083734-130083756 CAATCCCCTGTGGTCACCAAGGG - Intronic
1061740050 9:132696052-132696074 CTATTCCATGTGTCCTCCTTAGG - Intergenic
1185823329 X:3225737-3225759 AAATCCCCTGTTGCCACCATGGG - Intergenic
1201965579 Y:19730507-19730529 CAATCACCTATAGCCTCCATTGG - Intronic