ID: 1073287433

View in Genome Browser
Species Human (GRCh38)
Location 10:102397250-102397272
Sequence CATGCAGTTCTTTCTTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073287433_1073287439 20 Left 1073287433 10:102397250-102397272 CCTCAGGAAGAAAGAACTGCATG 0: 1
1: 0
2: 2
3: 30
4: 306
Right 1073287439 10:102397293-102397315 TCTTCTCAGATTTAACAACCTGG 0: 1
1: 0
2: 0
3: 11
4: 161
1073287433_1073287440 21 Left 1073287433 10:102397250-102397272 CCTCAGGAAGAAAGAACTGCATG 0: 1
1: 0
2: 2
3: 30
4: 306
Right 1073287440 10:102397294-102397316 CTTCTCAGATTTAACAACCTGGG 0: 1
1: 0
2: 0
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073287433 Original CRISPR CATGCAGTTCTTTCTTCCTG AGG (reversed) Intronic
901167340 1:7229923-7229945 CATCCAGATGTTTCTTCTTGGGG + Intronic
902581497 1:17410553-17410575 CATCCAGTTCCTTCTACCTCTGG - Intronic
903030008 1:20457183-20457205 CATGCTGTTCTTTCTGTCTAAGG - Intergenic
903615617 1:24653115-24653137 CTATCAGTTCTTTCTTCCAGGGG - Intronic
904841304 1:33373574-33373596 CTCGCTGTTCTTTGTTCCTGGGG - Intronic
904953219 1:34261207-34261229 CTTGCTGTTCTCTCTGCCTGGGG - Intergenic
905400762 1:37701389-37701411 CCTGCAGTGCTCCCTTCCTGGGG - Intronic
908313481 1:62909159-62909181 ACCGCAGTTCTTTTTTCCTGAGG - Intergenic
908804896 1:67920027-67920049 AAAGCAGTTTTTTCTGCCTGTGG + Intergenic
909343053 1:74553182-74553204 CATAGAGTTCATTTTTCCTGTGG + Intergenic
909677204 1:78251966-78251988 CAAGCAGAGCTTTCTCCCTGTGG + Intergenic
910867137 1:91798936-91798958 CATCCAGTTCCTTCTTCCCCTGG - Intronic
911090566 1:94013911-94013933 CATGCAGTTCTCTTCTCCAGAGG - Intronic
911094689 1:94045792-94045814 CACGCTGTTGTTCCTTCCTGGGG + Intronic
911479054 1:98413446-98413468 CATGCATTTCATTCTTTTTGTGG + Intergenic
911715035 1:101123260-101123282 CATCCAGTTCATTCTCCTTGTGG + Intergenic
913125641 1:115785550-115785572 CATCATGTTCCTTCTTCCTGTGG - Intergenic
914703832 1:150155667-150155689 CATACAGGTCTGTCTTACTGAGG + Intronic
917318755 1:173757461-173757483 CATGCTGTTCTTTTTTCCCTGGG + Intronic
917522803 1:175761990-175762012 CAAGAAGTGCTTTCTTCTTGAGG + Intergenic
918149599 1:181786843-181786865 CATTGATTTCTTTCTGCCTGTGG + Intronic
918205497 1:182304806-182304828 CATGCTGTTCTCTCTCCTTGTGG + Intergenic
918252394 1:182714919-182714941 CATCCATTTCTTTCTTCCTTTGG - Intergenic
918984775 1:191609371-191609393 CAGGAAGTTGCTTCTTCCTGGGG + Intergenic
920743433 1:208602836-208602858 CAGACAGTTCCTTCTACCTGGGG - Intergenic
921181822 1:212637380-212637402 CATGTAGCTCATTCTCCCTGTGG - Intergenic
921536107 1:216350738-216350760 CCTGCAGTTTTTCCTTGCTGAGG + Intronic
922069927 1:222182260-222182282 CATTCTGTTTTTTTTTCCTGTGG - Intergenic
923525873 1:234772343-234772365 CATTCAGTTTTTACTTGCTGCGG + Intergenic
923887636 1:238176880-238176902 CACTCAGTTCCTTCTTGCTGTGG + Intergenic
1062891491 10:1064090-1064112 CATCCTGTATTTTCTTCCTGAGG - Intronic
1064360723 10:14661896-14661918 CATGCAGTTCTCTCTGTCTGTGG + Intronic
1064379902 10:14832233-14832255 CTTGCTGTTCCTTCTGCCTGCGG - Intronic
1065354418 10:24825841-24825863 CAGGCTGTTCTTTCTTTTTGGGG - Intergenic
1065900289 10:30200167-30200189 CATGTAGTTTCTTCTTCCTGAGG - Intergenic
1066975400 10:42363639-42363661 GGTCCAGTTATTTCTTCCTGAGG - Intergenic
1067089451 10:43259169-43259191 CATGGATATCTGTCTTCCTGGGG - Intronic
1069088018 10:64164449-64164471 CTTGTTGTTCTTTCTTGCTGAGG + Intergenic
1069162495 10:65108728-65108750 CATGCATTCCTTTCTGCCAGAGG + Intergenic
1069452825 10:68530870-68530892 CAAGCACTTCTCTCTTACTGTGG + Intergenic
1069802420 10:71090407-71090429 CAAGCTGTTCCTTCTTCCTGGGG - Intergenic
1069890822 10:71651568-71651590 CATGCTGTTCTCTCCTCCAGTGG - Intronic
1070435571 10:76389178-76389200 CATGCCGTTCTCCCTTCATGAGG - Intronic
1071726241 10:88200761-88200783 CAAACAGTTCTTTGTTGCTGTGG - Intergenic
1071888641 10:89978321-89978343 CAGACAGAACTTTCTTCCTGAGG - Intergenic
1072172443 10:92878621-92878643 CAGGAAGTTGCTTCTTCCTGGGG + Intronic
1072604059 10:96963363-96963385 GATGCAGTTCCTTCTTGATGTGG + Intronic
1072832321 10:98671835-98671857 AATGCAATTTTTTCTCCCTGGGG - Intronic
1073210770 10:101800498-101800520 CATTCTGTTCTTTGTTTCTGTGG - Intronic
1073287433 10:102397250-102397272 CATGCAGTTCTTTCTTCCTGAGG - Intronic
1073704642 10:105969534-105969556 CATGCTATTCTTTCTTCCTGTGG - Intergenic
1074258942 10:111832606-111832628 CCTAGAGTTCTTTCTTCCTGTGG - Intergenic
1076127902 10:127990610-127990632 CATGCAGTAGTTACTTTCTGGGG - Intronic
1076557690 10:131339208-131339230 TATGCAGTTCTATCTCCCTGGGG + Intergenic
1078643431 11:13116678-13116700 TATGCCGTTCCTTCTGCCTGGGG + Intergenic
1079258078 11:18849933-18849955 CATCCAGATCTTTATTCCTAAGG + Intergenic
1079304478 11:19310123-19310145 CCTGCAGTTCTTATTTCGTGGGG + Intergenic
1080269367 11:30434455-30434477 GATCCAGTTGTTACTTCCTGGGG - Intronic
1084095820 11:66910590-66910612 CATGCAGATCTTGCTTCCACCGG - Intronic
1084444045 11:69193175-69193197 CATGGGGCTCTTTCTTCCTGAGG + Intergenic
1084838550 11:71825937-71825959 CAAGAAGTTGCTTCTTCCTGGGG - Intergenic
1084856226 11:71988872-71988894 CATGAAATTCTTTCTTCTAGGGG + Intronic
1085021508 11:73213106-73213128 CATGCTTTTCCTTCTTCCTGGGG - Intergenic
1085817464 11:79755244-79755266 CATGCTGTTCCTTCTGCCTGGGG + Intergenic
1087285135 11:96256916-96256938 TATTCATTTCTTTCTTACTGGGG - Intronic
1087378182 11:97369945-97369967 CCTGCACTTCTTTCTGCATGTGG - Intergenic
1087408376 11:97758181-97758203 CATGCTGTTTTTTTTTCCTCTGG - Intergenic
1088906310 11:114157857-114157879 CATTCTGTTCTTCCTTCCTGTGG + Intronic
1089817819 11:121192242-121192264 CATCCATTTCTATCTTGCTGAGG - Intergenic
1090495445 11:127206766-127206788 AATGCAGTTCCTCCTGCCTGAGG + Intergenic
1091900084 12:4137475-4137497 AATGCAGTCCTGTCTTCCCGGGG - Intergenic
1092400143 12:8168159-8168181 CAAGAAGTTGCTTCTTCCTGGGG + Intronic
1092526663 12:9313864-9313886 CATGGAGACCTTTGTTCCTGTGG + Intergenic
1092540610 12:9417915-9417937 CATGGAGACCTTTGTTCCTGTGG - Intergenic
1092943233 12:13429646-13429668 CATCCTCTTCTTTCTTTCTGGGG - Intergenic
1094425155 12:30309666-30309688 AAGGCATTTCTTTCTTTCTGGGG - Intergenic
1094498540 12:31004303-31004325 ACTCCAGCTCTTTCTTCCTGGGG + Intergenic
1095649982 12:44596147-44596169 AATGCAGTTCTTTTCTCTTGGGG - Intronic
1095709047 12:45268797-45268819 CAGACAGACCTTTCTTCCTGGGG - Intronic
1095791771 12:46175437-46175459 GAAGCAGTCCTTTCTGCCTGGGG - Intergenic
1097919567 12:65057027-65057049 CATGCAGATCCTGCTTTCTGGGG - Intronic
1100910170 12:99351201-99351223 CATGCAAGTCTTATTTCCTGAGG + Intronic
1101567511 12:105922224-105922246 CTGGCAGTTCTTTCTTACTGGGG + Intergenic
1102506399 12:113387128-113387150 CAGGAAGTTCTGTGTTCCTGCGG - Intronic
1102841271 12:116126412-116126434 GGTGCAGTGGTTTCTTCCTGTGG + Intronic
1103241418 12:119416502-119416524 AATGAAGTTCTTTATTACTGAGG + Intronic
1103296260 12:119889694-119889716 CATGCAGGGCTATCTGCCTGTGG + Intergenic
1103864423 12:124040548-124040570 AATGCTGTTATTTCCTCCTGAGG + Intronic
1104015574 12:124959600-124959622 CATCCTGTACTTTATTCCTGTGG - Intronic
1104888703 12:132128066-132128088 CATACATTTCTTTCTACCAGAGG - Intronic
1105882335 13:24615729-24615751 TATGCAGTTCCTGCTGCCTGGGG + Intergenic
1105977512 13:25485520-25485542 CATGAACATCTGTCTTCCTGGGG + Intronic
1107306497 13:39025925-39025947 CATACAGTGTTTCCTTCCTGGGG - Intronic
1108065674 13:46575171-46575193 CCAGCAGTTCTCTGTTCCTGTGG - Intronic
1108436984 13:50410514-50410536 CATGGGGTTCCTTCTTTCTGTGG + Intronic
1109226955 13:59708539-59708561 CCTGAAATTCTTTCTTCCTTTGG + Intronic
1109414426 13:62019267-62019289 CATTCAGGTCTTTCTTACTTGGG + Intergenic
1110551054 13:76811962-76811984 TAAGCATTGCTTTCTTCCTGTGG + Intergenic
1111409348 13:87854057-87854079 CATGCCCTCCTTTCTCCCTGTGG - Intergenic
1111501281 13:89123277-89123299 TATGCACTTCTTATTTCCTGGGG + Intergenic
1112825896 13:103392330-103392352 CATGCAGCTTTTTCCTCCAGGGG - Intergenic
1114559398 14:23579342-23579364 CCTCCAGTGCTTTCTTCCGGAGG - Intergenic
1114876661 14:26728578-26728600 AATGCTGTTCTGTCTTCCTGCGG + Intergenic
1117942986 14:60988868-60988890 CATGCATTTGAATCTTCCTGAGG + Intronic
1118363817 14:65077391-65077413 GATCAAGTTCTTTGTTCCTGGGG - Intronic
1119079990 14:71684105-71684127 CAAGGAGTACTTTCTTCTTGGGG - Intronic
1121467374 14:94124641-94124663 CATGCAGACCTTTTTCCCTGCGG - Intergenic
1121699102 14:95938563-95938585 CATGCAATCCTTTCTTGATGAGG - Intergenic
1121895156 14:97639920-97639942 ATTGCAGTTCTTTCTTCCCCGGG + Intergenic
1124019555 15:25907041-25907063 CATTCAGTTCTATCTTCTAGGGG - Intergenic
1124997627 15:34739085-34739107 CAAGCATTTCTCTTTTCCTGAGG + Intergenic
1125821818 15:42638290-42638312 CAAGCAGGTCTTTCCTTCTGTGG + Intronic
1128382823 15:67125922-67125944 CATGCAGTTGTCCCATCCTGTGG - Intronic
1129682520 15:77665798-77665820 CAGGCAGTTCCCTCTGCCTGTGG + Intronic
1131278704 15:91003742-91003764 CATGCATTTCTTTCTGGCTAAGG + Intronic
1134337684 16:13316370-13316392 CATTCTGTTCTCGCTTCCTGGGG - Intergenic
1135803449 16:25520491-25520513 CCCTCAGTTCTTTCTGCCTGGGG + Intergenic
1137246513 16:46710538-46710560 CGTGAAGGTCCTTCTTCCTGTGG - Intronic
1138141420 16:54571810-54571832 CATGCAATGTGTTCTTCCTGTGG - Intergenic
1138244987 16:55460720-55460742 CACTCAGCTCTTTCTCCCTGCGG - Intronic
1140355554 16:74302902-74302924 CATCGAGCTCTGTCTTCCTGGGG + Intronic
1142573270 17:889375-889397 CATTCATTTCTACCTTCCTGTGG - Intronic
1142932557 17:3299347-3299369 AATGCAGTGCTTTCTCCCTCAGG + Intergenic
1145995553 17:29102990-29103012 CATGCAGGGCTTCCTGCCTGTGG + Intronic
1147314800 17:39614634-39614656 CAGGCTGTTCTGTCTTCCTGAGG + Intergenic
1147459656 17:40560139-40560161 CAGGAACTTATTTCTTCCTGAGG + Intronic
1147503752 17:40992942-40992964 CATCCATTTGTTTCTTCCTACGG - Intergenic
1149045796 17:52243944-52243966 CATGGAGTTGTTTCTTCCATGGG + Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1150284238 17:63946423-63946445 CCAGCAGATCTCTCTTCCTGGGG + Intronic
1151004835 17:70422315-70422337 CATGCAGATCATTCCTTCTGGGG + Intergenic
1151461456 17:74256576-74256598 CATGTCGTTCTTTCTTCCTGGGG + Intronic
1155686574 18:28559791-28559813 CATGCTCTGCTTTCTGCCTGTGG - Intergenic
1156244421 18:35284220-35284242 CATGCACTTCTTCCTCTCTGAGG - Intronic
1157987119 18:52450657-52450679 GATGAAGTTCTATCTTCCTGAGG - Intronic
1158328332 18:56333877-56333899 CATGCAGTTCTTACAGCCTGGGG + Intergenic
1158979440 18:62744961-62744983 CATGCTGTACTTCCTTCCTTTGG - Intronic
1159203263 18:65216525-65216547 CCTTCTGTTCTTCCTTCCTGTGG - Intergenic
1160437369 18:78862065-78862087 CAGAAGGTTCTTTCTTCCTGAGG + Intergenic
1161915820 19:7227215-7227237 CACACAGTTCTTTGTTCCAGAGG - Intronic
1163197008 19:15728919-15728941 CCTTCAGTTCTTTGTTCCTGAGG - Exonic
1164608342 19:29615997-29616019 CATGCAGTACTCTGCTCCTGGGG - Intronic
1165265008 19:34654682-34654704 CATGCAGTTCCTTCTGGGTGGGG - Intronic
1166186334 19:41141549-41141571 CTTGCTGTTCCTTCTCCCTGAGG - Intergenic
1167163571 19:47782894-47782916 AAAGTAGTTCTTTGTTCCTGAGG - Intronic
1167553206 19:50175307-50175329 CATACAATTCTTTGTTGCTGGGG + Intergenic
926749753 2:16189336-16189358 CATGCTGCTCCTTCTGCCTGGGG - Intergenic
928696096 2:33851693-33851715 CGTGCAGGTCCTTCTCCCTGGGG - Intergenic
930018220 2:46985192-46985214 CTTCCTCTTCTTTCTTCCTGAGG + Intronic
932679599 2:73813517-73813539 TCGGCAGTTCTCTCTTCCTGTGG + Exonic
933157114 2:78988636-78988658 CTGACAGTTCTTACTTCCTGGGG - Intergenic
933486047 2:82925402-82925424 CATTCAGTTGTTTCTTTCTGGGG - Intergenic
933892575 2:86785441-86785463 CATTCAGGTCTTTCTTTCCGAGG - Exonic
935252821 2:101279720-101279742 AATGCAGTCTTTTCTTCCTCTGG + Intronic
935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG + Intergenic
935956577 2:108382963-108382985 CATACAGTTCATTTTTTCTGAGG - Intronic
937529213 2:122808480-122808502 TATAGATTTCTTTCTTCCTGTGG - Intergenic
938168110 2:129050297-129050319 CACCCAGTTCGATCTTCCTGTGG + Intergenic
938920105 2:135987082-135987104 CATGTACTTCTTTCTTACTTTGG + Intergenic
939359286 2:141148268-141148290 CATGCTGATCTTTATGCCTGAGG + Intronic
941764625 2:169283579-169283601 CATAGATTTGTTTCTTCCTGAGG - Intronic
942275091 2:174315527-174315549 AATACAGTTTTTTTTTCCTGTGG - Intergenic
943247434 2:185473462-185473484 CATGCAGTTCCTCCTGCCCGTGG + Intergenic
943621693 2:190155369-190155391 TATTAAATTCTTTCTTCCTGTGG - Intronic
944041719 2:195363281-195363303 CAGGTAGTTCTGTCTTCCTTTGG - Intergenic
945627490 2:212229000-212229022 CATGCTGCCCTTTCTTCCTTGGG - Intronic
945735923 2:213600285-213600307 CATTATATTCTTTCTTCCTGAGG + Intronic
947125937 2:226868388-226868410 CATGCTGCACTTTCTTCCTTTGG + Intronic
948037204 2:234867431-234867453 CAGGCAGTTCTTGCTTGCAGTGG + Intergenic
1169561579 20:6806736-6806758 CATGCTTTTATTTCTTCATGTGG - Intergenic
1169782700 20:9326319-9326341 GATGATGTTCTTTATTCCTGAGG + Intronic
1170686558 20:18574860-18574882 CAAGCAGTTCTATCTTCCAGCGG + Intronic
1171129283 20:22634134-22634156 CATGCTGTTCCCTCTGCCTGGGG - Intergenic
1174077196 20:47946082-47946104 CATGCAGACCTTTCTTGCTCCGG - Intergenic
1175356524 20:58373331-58373353 CCTTCTGTTATTTCTTCCTGTGG - Intergenic
1175668881 20:60884156-60884178 CATGCAGTGCCTTCTTGGTGCGG - Intergenic
1177039027 21:16083341-16083363 CAACCAGTTCTTCTTTCCTGGGG - Intergenic
1180036225 21:45251706-45251728 AATGCAGTTCTCTAATCCTGAGG - Intergenic
1181441412 22:22937472-22937494 CATACAATTCTTCCTGCCTGAGG - Intergenic
1181444193 22:22956286-22956308 CCTGCAGGTCTCCCTTCCTGTGG + Intergenic
1181480201 22:23193989-23194011 CATCCAGTTCTCTGTCCCTGAGG + Intronic
1182863662 22:33583287-33583309 CATGCACTGCCTTCATCCTGTGG - Intronic
949939040 3:9139865-9139887 CATGCAAATCTTGCTTCATGAGG - Intronic
950205324 3:11075806-11075828 CATGCTCTTCCTTCTGCCTGTGG + Intergenic
950418452 3:12882646-12882668 CATGCTGGGCTTTCCTCCTGGGG + Intergenic
950915335 3:16638847-16638869 CATTCAGTTATTACTTACTGAGG + Intronic
952682406 3:36109627-36109649 CATAAAGTTCTGTCTCCCTGGGG - Intergenic
954457895 3:50609883-50609905 CATGCTGTCCTCTCTACCTGGGG - Intronic
954923634 3:54213522-54213544 CAGTCCTTTCTTTCTTCCTGTGG + Intronic
955204827 3:56886377-56886399 CTTTCTGTTCTCTCTTCCTGTGG - Intronic
955997248 3:64689194-64689216 CTTGAAATTCTATCTTCCTGAGG - Intergenic
957585990 3:82132673-82132695 CATGCAGCTATTCCTTTCTGAGG + Intergenic
960843723 3:121987134-121987156 AATACAGTCCTTTCTTCCTGGGG + Intergenic
964530662 3:157664218-157664240 CATTCAGTGCTTTCTCCCTAGGG - Intronic
965150963 3:164974349-164974371 CAGGAAGTTGCTTCTTCCTGAGG + Intergenic
965381979 3:168001090-168001112 GATACATTTATTTCTTCCTGTGG + Intergenic
965793076 3:172410831-172410853 CATGCACTTCCTTCCTTCTGAGG - Intergenic
966034788 3:175398438-175398460 CATACAGTGCTTTCATCATGTGG - Intronic
966561435 3:181324999-181325021 CATCCAGTTCAAACTTCCTGGGG + Intergenic
966644430 3:182227729-182227751 CATTAAGTTCTTGCTTTCTGTGG - Intergenic
966935738 3:184707587-184707609 AATGGAGGTCTTTCATCCTGAGG + Intergenic
967447233 3:189580898-189580920 AATCCTGTTCTTCCTTCCTGAGG - Intergenic
968402150 4:307031-307053 CATGGTGCTCTCTCTTCCTGTGG - Intergenic
968410243 4:384267-384289 CATGGTGCTCTCTCTTCCTGTGG + Intronic
968421445 4:488482-488504 CATGGTGGTCTCTCTTCCTGTGG + Intronic
968976622 4:3825428-3825450 CACGCAGTGCTTTCATTCTGGGG - Intergenic
969463492 4:7341278-7341300 CATGCTGTTCTTTCTCTCTTGGG + Intronic
971916536 4:32876861-32876883 CATACAGTGCTTTCTGCCTGAGG + Intergenic
972840747 4:42927647-42927669 CTTGCAGTTCTTTCTTTCTTAGG - Intronic
973269079 4:48242682-48242704 CAGGAAGTTCTTTTTTTCTGAGG + Intronic
973726167 4:53778402-53778424 GTTTCAGTTCTGTCTTCCTGAGG + Intronic
974601755 4:64092235-64092257 CATGCTGTTCTTCATTCCTTAGG + Intergenic
975004131 4:69266343-69266365 CATGTAGTTTGTTTTTCCTGAGG + Intergenic
975590654 4:75996447-75996469 CATGTATTTCTTTGCTCCTGTGG + Intergenic
975858058 4:78645995-78646017 TTTTCAGTTCTGTCTTCCTGAGG + Intergenic
977985675 4:103380015-103380037 CAAGCAGTAGTTTCTCCCTGTGG - Intergenic
979591158 4:122482047-122482069 CAGTCAGTCCTTTCTTGCTGAGG - Intergenic
980007612 4:127559519-127559541 CATGCATTTCTTTCCCTCTGAGG + Intergenic
981282544 4:142975080-142975102 GATGCAGTTCTTCTTTCCTAGGG - Intergenic
982839396 4:160163797-160163819 CTTGTAGTTCTCTTTTCCTGTGG + Intergenic
985680220 5:1252223-1252245 CTTCCAGTTCCTTCTGCCTGAGG + Intergenic
986445505 5:7817395-7817417 AATACAGTTCCATCTTCCTGGGG + Intronic
987167819 5:15219516-15219538 CATTCAGGTGTTTCTTCCAGAGG + Intergenic
987489335 5:18556545-18556567 GATGCATTTCTTTCTTCTTAAGG - Intergenic
987621105 5:20339285-20339307 CAGACAGGTCTTTCCTCCTGAGG + Intronic
987694768 5:21313894-21313916 CATGAATTTCTCTCTTCTTGAGG - Intergenic
990037217 5:51336140-51336162 CATGCGGTGCTTTCTTCCAGTGG - Intergenic
990357716 5:54986595-54986617 CATGCAGACCTTGTTTCCTGAGG - Intronic
991745465 5:69735547-69735569 CATGAATTTCTCTCTTCTTGAGG + Intergenic
991752242 5:69819680-69819702 CATGAATTTCTCTCTTCTTGAGG - Intergenic
991797032 5:70315276-70315298 CATGAATTTCTCTCTTCTTGAGG + Intergenic
991824843 5:70610861-70610883 CATGAATTTCTCTCTTCTTGAGG + Intergenic
991831561 5:70694803-70694825 CATGAATTTCTCTCTTCTTGAGG - Intergenic
991889411 5:71314831-71314853 CATGAATTTCTCTCTTCTTGAGG + Intergenic
992197552 5:74354863-74354885 CAGGCAATTCTGTCTTCATGCGG - Intergenic
992552649 5:77873975-77873997 CATTGTGTTCTTTCTACCTGTGG - Intergenic
992709187 5:79431895-79431917 GATCCAGTTCTTGCTTCATGGGG - Intronic
993133680 5:83930281-83930303 CCTGCCATTCTTTCATCCTGGGG - Intergenic
994465597 5:100125670-100125692 GATGCCCTTCTTTCTGCCTGTGG + Intergenic
995098252 5:108265985-108266007 CCTTCAGTTTTTTCTTACTGAGG + Intronic
995426957 5:112035672-112035694 CCAGGATTTCTTTCTTCCTGAGG - Intergenic
997602475 5:135150022-135150044 CAGGCAGCTCTTTCTTCCCAGGG + Intronic
998740596 5:145196399-145196421 TGTGCAGTTGATTCTTCCTGTGG + Intergenic
999442877 5:151616088-151616110 CATGCACATCGTTCTGCCTGAGG + Intergenic
999522050 5:152360870-152360892 CACGAAATTCTTTCTTCTTGAGG - Intergenic
999720374 5:154394885-154394907 CATGCAGCATTTTCGTCCTGGGG + Intronic
1000200571 5:159006176-159006198 CATGCAGTTTTCTCTTGATGGGG - Intronic
1000228591 5:159293868-159293890 CATACAGTCTTTGCTTCCTGAGG - Intergenic
1000981281 5:167819663-167819685 GGTGCAGTTCATTCTGCCTGTGG + Intronic
1001041331 5:168337701-168337723 GATGCATTTCTTTCTTTCTTTGG - Intronic
1002644258 5:180645490-180645512 CCTGCATTTCCCTCTTCCTGCGG - Intronic
1002775930 6:327475-327497 CATGCATTCCTTTCTTCATTTGG + Intronic
1003462350 6:6341770-6341792 CCTTCATTTCTTTGTTCCTGGGG - Intergenic
1004464945 6:15876116-15876138 CATGCAGGTCTTTCTTCAAACGG + Intergenic
1004495380 6:16158013-16158035 CATGTTGTTCTTTCTTTTTGGGG - Intergenic
1004696535 6:18039078-18039100 CATGCAGTAGTTTCTCACTGGGG - Intergenic
1005264967 6:24102110-24102132 CACTCAGTTCTGTCTTGCTGAGG - Intergenic
1005556134 6:26986034-26986056 CATGAATTTCTCTCTTCTTGAGG + Intergenic
1005890502 6:30133921-30133943 CATGCAGGTCTTTTTTAATGTGG + Intergenic
1006535914 6:34698587-34698609 CCTGCAGTTCCGCCTTCCTGGGG - Intergenic
1007120653 6:39377887-39377909 CAAGGAGATCTTTGTTCCTGGGG + Intronic
1007934172 6:45718623-45718645 CATGCCTGTCTTTCTTCCTGAGG - Intergenic
1008713029 6:54252931-54252953 CATTCAGTTCATACTTCCTAAGG + Intronic
1008881138 6:56381540-56381562 CATGCATTTCTTTGTAACTGAGG - Intronic
1009520127 6:64671023-64671045 AATAAAGTACTTTCTTCCTGTGG - Intronic
1011811106 6:91133286-91133308 CATGCAGTTCTTAGTGGCTGAGG + Intergenic
1013176859 6:107685248-107685270 CATGCAGCACTTCCATCCTGAGG - Intergenic
1013403462 6:109820865-109820887 CATGCAGGTCTTTATGGCTGTGG - Intronic
1013816278 6:114102291-114102313 CACATAGTTCTTTCTACCTGAGG + Intronic
1014046389 6:116892874-116892896 CAAGTAGTTCTTTATTGCTGAGG + Intronic
1014488573 6:122033369-122033391 CAAGCATTTTTTTCTTCCTTAGG - Intergenic
1014708119 6:124773363-124773385 TTTGCATTTCTTTTTTCCTGCGG + Intronic
1016331324 6:142954982-142955004 CTTTCAGTTCTCTCTTTCTGGGG - Intergenic
1016648471 6:146436956-146436978 AATGCAGTTCATTCTTGGTGTGG - Exonic
1017311346 6:152981601-152981623 CAGGCAGTCATTTCTTTCTGAGG + Intronic
1020761256 7:12269988-12270010 CATGCACTTCATTCTCGCTGAGG + Intergenic
1021859379 7:24891146-24891168 CCTGCAGTTCTGTTTTCATGAGG - Intronic
1021890789 7:25184452-25184474 CATGCAGTTGTTTGTCCTTGTGG + Intergenic
1022585044 7:31600806-31600828 CAGGAAGTTGCTTCTTCCTGGGG + Intronic
1022837351 7:34130851-34130873 CATGCTGTTCCTTCTAGCTGGGG - Intronic
1023071764 7:36441875-36441897 CATTCCTTTCTTTCTTCCTTGGG + Intronic
1023542554 7:41281692-41281714 CATGCAATTCTTTCTGCTTTAGG + Intergenic
1024713096 7:52040077-52040099 AATACAGTTCTTTTTTCCTAGGG + Intergenic
1029783040 7:102755028-102755050 CATGCATTTTTTTCTTCTTAAGG - Intronic
1029993303 7:104982757-104982779 TTTGCAGTTTTTTTTTCCTGTGG + Intergenic
1031071671 7:117168809-117168831 CATCCAGTTCTTCCTTCATTAGG - Intronic
1032400516 7:131620987-131621009 CATGCTGGCCTTTGTTCCTGGGG + Intergenic
1032738358 7:134713398-134713420 CATGCAGTTCCCTCTGACTGTGG + Intergenic
1032945431 7:136846641-136846663 CCTGAACTTATTTCTTCCTGTGG - Intergenic
1036277387 8:7367396-7367418 CAAGAAGTTGCTTCTTCCTGGGG - Intronic
1036343943 8:7942939-7942961 CAAGAAGTTGCTTCTTCCTGAGG + Intronic
1036839285 8:12103706-12103728 CAAGAAGTTGCTTCTTCCTGAGG + Intergenic
1037285724 8:17297104-17297126 CATGCATTTCATTTTTCCTGTGG - Exonic
1038280826 8:26162814-26162836 CATGCAGCTCCATCTTCCTCAGG + Intergenic
1038958278 8:32490615-32490637 CATACTGATCTTTCTTCATGTGG - Intronic
1039101760 8:33948944-33948966 TATGGTGTTCATTCTTCCTGGGG - Intergenic
1039366498 8:36933523-36933545 CATGCATTTCTATCTTCCTCAGG - Intronic
1041648413 8:60277317-60277339 CCTGTGGTTCTTTCTGCCTGTGG - Intronic
1041734299 8:61093741-61093763 AATGCAGTGATTTCTTGCTGGGG - Intronic
1041863183 8:62537392-62537414 TAAGCAGTTCTTTCTTCATGGGG + Intronic
1045590888 8:103595691-103595713 CAGTCAGTTCATTCTTCTTGGGG + Intronic
1045660825 8:104435959-104435981 CATGAAGAGCTTTCCTCCTGGGG + Intronic
1046097892 8:109581964-109581986 CATGAAGTTCTTTCTACCATGGG - Intronic
1046336798 8:112801127-112801149 CATTCAGTATTTTCTTCCTTTGG - Intronic
1046774992 8:118154522-118154544 TATGCTCTTCTTTCTTCCTGGGG - Intergenic
1048148231 8:131866506-131866528 CATGCTGTTCTATTTTCCAGAGG + Intergenic
1049104597 8:140603974-140603996 CATGCAGCTCCTTCACCCTGAGG - Intronic
1051199755 9:14603402-14603424 CATGCATTTAATTCTTCCAGTGG - Intergenic
1051690920 9:19711215-19711237 CATGCAGTGGATTCTTCCAGAGG + Intronic
1051880540 9:21835325-21835347 CTTTAAGTTCTTTCTTCGTGAGG - Intronic
1052102349 9:24464086-24464108 CATTCAATTGTTTCTTTCTGGGG - Intergenic
1052320801 9:27165361-27165383 CATGCAGCTCTTGCTCTCTGTGG - Intronic
1052419827 9:28228431-28228453 CATACATATCTTTCTTCCTTTGG + Intronic
1053547336 9:39037009-39037031 CATACAGCTTTTCCTTCCTGTGG - Intergenic
1055076428 9:72220180-72220202 CATGCAGTATTGTCTTTCTGGGG - Intronic
1056284202 9:85071438-85071460 CTTGTTGTTCTTTCTTCGTGTGG - Intergenic
1057058566 9:91983012-91983034 CATGTAGTTCTGTATTCCAGGGG - Intergenic
1058817659 9:108700067-108700089 CTAGAAGTTCTTTCTGCCTGTGG + Intergenic
1060733740 9:126053351-126053373 CATGCTGTTCCCTCTGCCTGGGG + Intergenic
1185509154 X:649945-649967 CATCCAATTCCTTCTCCCTGTGG - Intronic
1186358059 X:8807996-8808018 CTTGAAGTTCTTCCTTCCTTTGG - Intergenic
1187269406 X:17766105-17766127 CATGCATTTCGGTCTTCCTGTGG + Intergenic
1187361305 X:18630129-18630151 TATCCATTTTTTTCTTCCTGGGG + Intronic
1187648031 X:21370576-21370598 CTTGAAGGTCTTTCTTCCAGTGG + Intergenic
1187660347 X:21539496-21539518 CATACAGTTTTTTTTTCCTTTGG + Intronic
1188865829 X:35312122-35312144 CAAGAAGTTGCTTCTTCCTGAGG + Intergenic
1189185081 X:39047809-39047831 CATGAAATTATTTCTTTCTGTGG - Intergenic
1189280475 X:39817284-39817306 CAAGCAGGCCTTTCATCCTGAGG + Intergenic
1190282918 X:48942893-48942915 CAAGCAGCTCTTCTTTCCTGAGG - Intronic
1193139529 X:78012458-78012480 CAAGCAGATTTTTCTTTCTGAGG - Intronic
1194142700 X:90224108-90224130 CATGCAGTATTTGCTTTCTGTGG - Intergenic
1195786282 X:108527495-108527517 CATGCATCTCTTTCATACTGTGG - Intronic
1199061567 X:143361596-143361618 CATCCATGTCATTCTTCCTGTGG + Intergenic
1199314183 X:146358043-146358065 AATGCAGATCTTTCTTCTTCTGG + Intergenic
1199820327 X:151439287-151439309 CATGCTGTTCTTTCTTCCATAGG + Intergenic
1200488457 Y:3793211-3793233 CATGCAGTATTTGCTTTCTGTGG - Intergenic
1201501077 Y:14643291-14643313 CATGCCATTCTTTCTTCCTTGGG - Intronic
1201785489 Y:17772674-17772696 CTTGCATTTTTTTCTTCCTTTGG - Intergenic
1201816064 Y:18133313-18133335 CTTGCATTTTTTTCTTCCTTTGG + Intergenic